ID: 1053103407

View in Genome Browser
Species Human (GRCh38)
Location 9:35390407-35390429
Sequence CCATAGGCAAGATGGGCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 179}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053103407_1053103424 26 Left 1053103407 9:35390407-35390429 CCCCAGGCCCATCTTGCCTATGG 0: 1
1: 0
2: 0
3: 11
4: 179
Right 1053103424 9:35390456-35390478 GCCACTGGCCCCTGGCCCCTGGG 0: 1
1: 0
2: 4
3: 83
4: 419
1053103407_1053103421 18 Left 1053103407 9:35390407-35390429 CCCCAGGCCCATCTTGCCTATGG 0: 1
1: 0
2: 0
3: 11
4: 179
Right 1053103421 9:35390448-35390470 CTTGTCCTGCCACTGGCCCCTGG 0: 1
1: 0
2: 2
3: 32
4: 360
1053103407_1053103418 11 Left 1053103407 9:35390407-35390429 CCCCAGGCCCATCTTGCCTATGG 0: 1
1: 0
2: 0
3: 11
4: 179
Right 1053103418 9:35390441-35390463 GCCCTCACTTGTCCTGCCACTGG 0: 1
1: 0
2: 2
3: 10
4: 156
1053103407_1053103423 25 Left 1053103407 9:35390407-35390429 CCCCAGGCCCATCTTGCCTATGG 0: 1
1: 0
2: 0
3: 11
4: 179
Right 1053103423 9:35390455-35390477 TGCCACTGGCCCCTGGCCCCTGG 0: 1
1: 2
2: 15
3: 91
4: 554

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053103407 Original CRISPR CCATAGGCAAGATGGGCCTG GGG (reversed) Intronic
900400778 1:2472062-2472084 CCAGAGTCAGGCTGGGCCTGAGG - Intronic
902760144 1:18575675-18575697 CCCTAGGCAAGACGGAGCTGGGG - Intergenic
902827546 1:18987394-18987416 CCCGAGGCAAGAAGGGGCTGGGG - Intergenic
904928460 1:34066813-34066835 CCACAGTCAGGATGGGCTTGGGG + Intronic
905940285 1:41857685-41857707 CCATCTACAAGATGGGCATGAGG - Intronic
909823584 1:80097851-80097873 CCATAGTTAAAATGGGCCTTGGG - Intergenic
909920286 1:81373301-81373323 CCCTAAGCAGGATGAGCCTGGGG + Intronic
914255683 1:145960283-145960305 CCAGAGTCTAGGTGGGCCTGGGG - Exonic
914334325 1:146701041-146701063 CCAGAGGGAAGACAGGCCTGAGG + Intergenic
915168269 1:153960580-153960602 GCATTGGCATGATGGGCCAGGGG - Exonic
917210594 1:172628084-172628106 GGATAGGCAATATGGCCCTGTGG - Intergenic
922875242 1:228935335-228935357 CCTTTGGCAAGAGAGGCCTGGGG - Intergenic
924176000 1:241391533-241391555 CCATAGGCAGGATTATCCTGAGG + Intergenic
1064096353 10:12427281-12427303 CCCTAGGCAAAAGGGGCCAGGGG + Intronic
1067305041 10:45055912-45055934 CCATGGGCAAGATCAACCTGGGG + Intergenic
1069624720 10:69860695-69860717 CCACAGGCAAGGAGGGCATGGGG - Intronic
1071450328 10:85787319-85787341 GCATGGCCAAGATGGACCTGAGG - Intronic
1071576376 10:86729727-86729749 TCATAGGTGAGATGGGGCTGAGG - Intronic
1074192019 10:111146321-111146343 GCATAGTAAAGATGGGCATGTGG + Intergenic
1075023857 10:118969578-118969600 ACATGGGCAGAATGGGCCTGAGG + Intergenic
1075390394 10:122087084-122087106 CGAGAGGCCAGAGGGGCCTGGGG + Exonic
1075839316 10:125486065-125486087 CCACAGCCAAGAGGGGCCTAAGG + Intergenic
1076583791 10:131532104-131532126 CCAGAGGCCAGATAGGCTTGAGG - Intergenic
1076690874 10:132223382-132223404 CCACAGGCCAGATGAGCCCGGGG + Intronic
1076773282 10:132678938-132678960 CCATTGGCCATCTGGGCCTGAGG - Intronic
1077465725 11:2732876-2732898 CCTCAGGCAAGATGGGGCTGGGG - Intronic
1077795254 11:5484792-5484814 CCAGAGGCAAGTTGGTACTGTGG - Intronic
1080178081 11:29391671-29391693 CCAAAGGTATGATGGGCTTGAGG + Intergenic
1080855884 11:36111246-36111268 CTACAGGCAGGATGAGCCTGGGG + Intronic
1083667919 11:64285467-64285489 CCATAGCCAAGATGGCCCCCGGG - Intronic
1084593882 11:70105817-70105839 TCACTGGCAAGATGGCCCTGGGG + Intronic
1085095708 11:73759874-73759896 CCTTAGGTTAGATGGGGCTGTGG - Intronic
1085557768 11:77440920-77440942 CCAAAAGCTAGATGGGCTTGGGG + Intronic
1085759422 11:79228982-79229004 TCATAGCCAAGAGGAGCCTGAGG - Intronic
1085921305 11:80960904-80960926 CCATAGGCAGAATAGCCCTGAGG - Intergenic
1088273277 11:108057688-108057710 CTATATGCAACATGGGCTTGTGG + Intronic
1088495441 11:110427361-110427383 GCATAGGCAAAATGGGGCAGGGG - Intergenic
1092841790 12:12549472-12549494 CTATAGGCAAAATGAGGCTGTGG - Intronic
1095600131 12:44003878-44003900 GCATAGGCAATGTGGCCCTGGGG + Intronic
1095958210 12:47818711-47818733 CCCTAGGCAACATCTGCCTGAGG - Intronic
1095968571 12:47885444-47885466 CCGTAGGCGAGATGGCCCCGGGG - Intronic
1098217094 12:68232341-68232363 CCAGAGGCAAGATGGTACTGTGG - Intergenic
1102111086 12:110366268-110366290 TGATAGGGAAGATGGGCCCGTGG + Intergenic
1111829714 13:93311884-93311906 ACAAAGGCAAGATGGGTCTTTGG + Intronic
1113902538 13:113804888-113804910 CCATAGGCCAGCTGGGACAGAGG - Exonic
1114383750 14:22235542-22235564 ACATAGGCAAAATGGGGCAGGGG - Intergenic
1114860352 14:26510693-26510715 CTAAAGGCAAAATGGGCATGTGG + Intronic
1117112317 14:52471208-52471230 CAATAGGCATGAAGGGCCTTGGG - Intronic
1117303785 14:54453409-54453431 TCCTAGGCAGGATAGGCCTGAGG + Intergenic
1118473820 14:66099164-66099186 TCAGTGGTAAGATGGGCCTGAGG - Intergenic
1119635676 14:76271278-76271300 CCATGGTCCAGATGGGGCTGAGG + Intergenic
1120739920 14:88096780-88096802 CTTCAGGCCAGATGGGCCTGCGG - Intergenic
1122621123 14:103058001-103058023 CCGCAGGCAACATGGGCCCGCGG - Intergenic
1122812514 14:104296098-104296120 CCAGACCCCAGATGGGCCTGGGG + Intergenic
1123035249 14:105469321-105469343 CCACACCCAGGATGGGCCTGGGG - Intronic
1125735063 15:41919130-41919152 CCAGAGGCAAGATGGGTGGGAGG - Intronic
1126173897 15:45717484-45717506 TCAAAGGCAAGGTGGGCCTCTGG + Intergenic
1127704821 15:61536330-61536352 CCTTAGGCATGATGCTCCTGAGG - Intergenic
1128578027 15:68789595-68789617 CCACTGGCAAGAGGGGGCTGAGG - Intronic
1128924774 15:71645158-71645180 CCAGAGGAAAGATGGTCTTGGGG + Intronic
1129360110 15:75019321-75019343 CCAGAGGCAAGAGGGGCAGGTGG - Exonic
1131829083 15:96343007-96343029 CCCGAGGCAGAATGGGCCTGGGG + Intergenic
1138660028 16:58511393-58511415 ACAGAGACAGGATGGGCCTGAGG - Intronic
1139310940 16:66027439-66027461 GCAAAGGCAAGAAGGGACTGGGG + Intergenic
1139999292 16:71010191-71010213 CCAGAGGGAAGACAGGCCTGAGG - Intronic
1141193260 16:81840354-81840376 CCATGGGCCAGATTGGCCTGGGG + Intronic
1142583323 17:955106-955128 ACACGGGAAAGATGGGCCTGTGG + Intronic
1144658585 17:17053591-17053613 CCATGGGCGAGATGGGGCAGGGG + Intronic
1144949129 17:18984692-18984714 CCAGAGACAGGCTGGGCCTGAGG - Intronic
1145219333 17:21075481-21075503 CCACAGACCACATGGGCCTGAGG - Intergenic
1145993101 17:29090956-29090978 CCACAGGCACACTGGGCCTGAGG - Intronic
1148439344 17:47703518-47703540 CCAGAGGCTAGGTGGGTCTGAGG + Intronic
1148809081 17:50279010-50279032 CCAGAGGCAAGGTGGGGATGGGG - Intronic
1149429917 17:56589440-56589462 TCAAAGGCAAGAGGAGCCTGAGG - Intergenic
1151994200 17:77598240-77598262 CCAGTGGCAGGATGGGGCTGAGG + Intergenic
1152569740 17:81116437-81116459 CCCGAGGCAGGAGGGGCCTGGGG - Exonic
1153489568 18:5632944-5632966 GCATAGGCAAGAGGGGCATTTGG - Intergenic
1158481385 18:57824535-57824557 CCATGGGCTAAATGGCCCTGGGG - Intergenic
1161838235 19:6662387-6662409 CCATCGGCAAGATGGTTGTGGGG - Intronic
1162019466 19:7862116-7862138 CCGCGGGCCAGATGGGCCTGGGG - Exonic
1165826436 19:38708551-38708573 GCATGGGCAACATGGGCTTGTGG - Intronic
1166346216 19:42167789-42167811 CCATAGGCAATATGGGCAATGGG - Intronic
1167478170 19:49712876-49712898 CCAGAGGAAAGAGGGGGCTGGGG + Intronic
926156040 2:10454517-10454539 CCAGAGGAAAGCTGGGCTTGTGG - Intergenic
926327561 2:11798274-11798296 CCTAGGGGAAGATGGGCCTGAGG + Intronic
927498381 2:23565498-23565520 CCGTAGGCAAGAGGGAGCTGGGG + Intronic
930123208 2:47776593-47776615 AGAGAGGAAAGATGGGCCTGAGG - Intronic
930485256 2:52003594-52003616 GCATAGCTAAGAAGGGCCTGGGG + Intergenic
933818469 2:86088315-86088337 CCTAAGGCAAGAGGCGCCTGTGG + Intronic
934188881 2:89767347-89767369 CCATAGACAGGTAGGGCCTGTGG + Intergenic
934581261 2:95441799-95441821 CCTTAGGGAAGCTGGGTCTGAGG - Intergenic
934598189 2:95634915-95634937 CCTTAGGGAAGCTGGGTCTGAGG + Intergenic
937345771 2:121124484-121124506 CCATACCCAAGAAGGGCCTCTGG + Intergenic
937738370 2:125318949-125318971 CCAGAGCCAAGCTGGCCCTGTGG - Intergenic
938734614 2:134175037-134175059 CCATGGGCAGGGTGGGGCTGTGG + Intronic
945295194 2:208163536-208163558 CCATGGGGAAGGTGAGCCTGTGG - Exonic
947529730 2:230901187-230901209 CCCTTGGCAGGATGGGGCTGGGG - Intergenic
948610278 2:239162327-239162349 CCAGGGGCAGGGTGGGCCTGGGG - Intronic
1168854386 20:998532-998554 CCTGAGGAAGGATGGGCCTGTGG + Intronic
1169074637 20:2753004-2753026 CCAGAGGCCAGGTGGGCGTGGGG + Intronic
1169758411 20:9067495-9067517 CCTTAAGCAAGAGGGGGCTGAGG - Intergenic
1169875550 20:10293358-10293380 TCATAGGCAGGATGAGCATGTGG + Intronic
1170898630 20:20438588-20438610 CCACAGGCAGCATGGGCCCGGGG + Intronic
1173222431 20:41140944-41140966 CCACAGGGAACATGGGCTTGGGG - Intronic
1173368590 20:42413491-42413513 TCATAAGTAAGATTGGCCTGGGG - Intronic
1173499111 20:43539519-43539541 CCACAGGCAACATGGAGCTGGGG + Intronic
1175505957 20:59484314-59484336 CCCTGGGTGAGATGGGCCTGTGG + Intergenic
1175729398 20:61343596-61343618 GCATAGGCAAGTTGTGCTTGCGG + Intronic
1181633942 22:24165719-24165741 CCTTAGGCAGGATGTGCCTAAGG + Intronic
949326770 3:2874853-2874875 CCACAGGCAAGGTTGGCCTGTGG - Intronic
949933768 3:9100955-9100977 CCATAGGCAGGAAGGACCAGTGG + Intronic
954683746 3:52359549-52359571 CCACAGGAAGGACGGGCCTGAGG + Intronic
957633177 3:82744781-82744803 CTATAGGCCAGAAGGGACTGGGG + Intergenic
957636290 3:82790507-82790529 CCAAAGTCAAGATGGGGCCGAGG - Intergenic
959395941 3:105838431-105838453 TCAGAGCCAAGATGGGCATGGGG + Intronic
961450786 3:127001429-127001451 CCAGGGGCAAGAGGGGCCAGGGG + Intronic
962091266 3:132246433-132246455 GCATAGGCAAGGGGGGCCTGGGG - Intronic
962456209 3:135567855-135567877 CCAAAGACCAGATGGGCATGAGG - Intergenic
963795404 3:149626360-149626382 CCATAGGAAATATGATCCTGAGG - Intronic
966948843 3:184797624-184797646 CCATAGGCAACATGTGGCTCAGG + Intergenic
969192224 4:5531413-5531435 CCATAGGCCGGATGGGTTTGTGG - Intergenic
969919037 4:10519650-10519672 CCATATGCCATCTGGGCCTGAGG - Intronic
970386764 4:15564180-15564202 CCATTGGGAAGATGAGTCTGAGG + Intronic
971398858 4:26256231-26256253 CCAAAGGCAGGGTGGGGCTGTGG - Intronic
971615376 4:28783123-28783145 CCCTAGCCAGGCTGGGCCTGTGG + Intergenic
972874567 4:43342851-43342873 CCAAAAGCAAAATGGGCCTTTGG - Intergenic
975498260 4:75057755-75057777 CCAAAGTCCAGAGGGGCCTGAGG - Intergenic
976270925 4:83229743-83229765 CCTTAGCCAAGATGGCCTTGGGG + Intergenic
979593982 4:122512468-122512490 CAATAGGCAAGATGAGGATGGGG + Intergenic
982164411 4:152602106-152602128 AGATAGGAAGGATGGGCCTGAGG + Intergenic
982171619 4:152667169-152667191 CAATAGGCCTGGTGGGCCTGTGG + Intronic
982802995 4:159727187-159727209 CCATACTCAAGATGGGCATTTGG - Intergenic
982805668 4:159759692-159759714 ACTTAGGCAAGCTGGGCATGTGG + Intergenic
982957646 4:161792242-161792264 CCAAAGCCCAGATGGGGCTGAGG - Intronic
985068287 4:186144506-186144528 GGATAGGCGAGATGGTCCTGTGG + Intronic
986073287 5:4308938-4308960 CCATAGGGAACGTGGGCCAGGGG + Intergenic
990208945 5:53460729-53460751 CCATAGCCAAGAGGAGCCTAAGG + Intergenic
991969072 5:72121122-72121144 CCATTTGCAAAATGGTCCTGTGG + Intronic
996061182 5:119035143-119035165 TCATAGGCAAGAGGAGCCTAAGG + Intergenic
999642415 5:153685176-153685198 CCTTAGGCAAGAGGGATCTGAGG + Intronic
1002052893 5:176581593-176581615 GCTTAGCCAGGATGGGCCTGGGG + Intronic
1005603224 6:27448526-27448548 CCATAGCCAAGAAAGTCCTGAGG + Intergenic
1006671070 6:35730097-35730119 CAATAGGCTTGATGGGACTGGGG - Intergenic
1009044267 6:58218720-58218742 GAATAGGCAAAATGGACCTGAGG + Intergenic
1009220093 6:60972985-60973007 GAATAGGCAAAATGGACCTGAGG + Intergenic
1014515188 6:122369053-122369075 CCATAGTCCAGACAGGCCTGTGG + Intergenic
1014653401 6:124069644-124069666 CCACAGGAAAGCTGGGACTGGGG - Intronic
1017229070 6:152052749-152052771 CCAAAGGCAGGATGGGGGTGAGG + Intronic
1017954439 6:159167313-159167335 CAGTAGCCAGGATGGGCCTGTGG - Intergenic
1018910572 6:168098901-168098923 CCCCAGGCAAGACAGGCCTGGGG + Intergenic
1019982301 7:4630427-4630449 CCATGGGCAAGATGTGGCTCTGG - Intergenic
1020282428 7:6656281-6656303 CCAAGGGCAAGGTGGGCTTGGGG + Exonic
1023088077 7:36592334-36592356 GCAGAGGGAAGATGGGACTGAGG + Intronic
1023375948 7:39555095-39555117 CCATTGGCAAGAAGGGCCCCTGG - Intergenic
1024012623 7:45282900-45282922 TCATAGCCAAGAGGGTCCTGAGG - Intergenic
1025874102 7:65463818-65463840 TCATAGGCAATCTGGCCCTGAGG - Intergenic
1028222603 7:88215176-88215198 TCATAGGCAGGATGGTTCTGTGG + Intronic
1029917890 7:104231033-104231055 CAATGGGCAAGAAGGTCCTGGGG + Intergenic
1033430937 7:141289035-141289057 CCATAGGCAGGAAGATCCTGGGG - Intronic
1035085362 7:156253374-156253396 GCCTCGGCACGATGGGCCTGGGG - Intergenic
1035844841 8:2852291-2852313 ACATGAGCAAGATGAGCCTGGGG + Intergenic
1036809969 8:11861182-11861204 CCATGGGACAGATGGGCCTCTGG - Intronic
1037246840 8:16845051-16845073 CGATAGGCCAGATGGGTCTGTGG - Intergenic
1037731392 8:21526599-21526621 CCACAGGCAAGCTGGGCCCTGGG + Intergenic
1038369352 8:26972579-26972601 CCGTAGGCAAGGTGGGCATGGGG + Intergenic
1038734551 8:30156847-30156869 CCAGAGACAGGAAGGGCCTGGGG - Intronic
1046752274 8:117938542-117938564 CCATAAGCCACATGGGACTGTGG - Intronic
1047374865 8:124286373-124286395 CTACAGGAAAGCTGGGCCTGGGG + Intergenic
1047636862 8:126773273-126773295 CCAAAGGCAAAATGTGCTTGAGG - Intergenic
1049542793 8:143215997-143216019 CCCCAGGAAAGACGGGCCTGGGG + Intergenic
1053103407 9:35390407-35390429 CCATAGGCAAGATGGGCCTGGGG - Intronic
1053177763 9:35941116-35941138 GCATAGGCAATCTGGGACTGTGG - Intergenic
1056263457 9:84872794-84872816 TCATAGGCCAGCTAGGCCTGAGG + Intronic
1057405230 9:94764310-94764332 CCACAGTCAAGAGGAGCCTGAGG + Intronic
1057794551 9:98146091-98146113 CCAGAGGGGACATGGGCCTGAGG - Intronic
1057820442 9:98326134-98326156 CCAAAGGAAAGATGGGGCCGGGG + Intronic
1058832920 9:108835400-108835422 GCATAGGCAGAATGGGCATGGGG + Intergenic
1061626136 9:131841787-131841809 CCAGAGGCAGGAGGGGCTTGGGG + Intergenic
1062273282 9:135719476-135719498 CCTTTGGAGAGATGGGCCTGTGG - Intronic
1185589197 X:1262635-1262657 ACATAAGCAAGATGGGCCAGGGG - Intergenic
1188379690 X:29476228-29476250 CCAGAGACAAGATGGCCATGTGG + Intronic
1189329868 X:40137616-40137638 CCAGAGGCAAGAGAGGACTGGGG - Intronic
1190127830 X:47722146-47722168 CCCCAGGCTAGATTGGCCTGAGG + Intergenic
1190621051 X:52287571-52287593 CCAAAGTCCAGAGGGGCCTGAGG - Intergenic
1194231711 X:91332703-91332725 CCATAAGCTAGAGGGGACTGCGG + Intergenic
1195225414 X:102787504-102787526 ACATAGGCAAAATGGGGCAGGGG - Intergenic
1196862851 X:120043865-120043887 CCAAAGGCAAGATGGGACTTTGG - Intergenic
1196880251 X:120192479-120192501 CCAAAGGCAAGATGGGACTTTGG + Intergenic
1197722965 X:129757384-129757406 CCATGGGGAAGAGGGGGCTGAGG - Intronic
1198159042 X:133988826-133988848 TCATAGGCAAGCTGGCCCTGAGG + Intergenic
1198746770 X:139899150-139899172 TCATAGCCAAGAAGAGCCTGAGG + Intronic