ID: 1053105647

View in Genome Browser
Species Human (GRCh38)
Location 9:35405736-35405758
Sequence GGACTGAGGCTGCCACAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053105646_1053105647 -10 Left 1053105646 9:35405723-35405745 CCGTCTTGGCAGAGGACTGAGGC No data
Right 1053105647 9:35405736-35405758 GGACTGAGGCTGCCACAGACAGG No data
1053105644_1053105647 -9 Left 1053105644 9:35405722-35405744 CCCGTCTTGGCAGAGGACTGAGG No data
Right 1053105647 9:35405736-35405758 GGACTGAGGCTGCCACAGACAGG No data
1053105639_1053105647 14 Left 1053105639 9:35405699-35405721 CCCACTGGGGAGAGGTGTGCCTG No data
Right 1053105647 9:35405736-35405758 GGACTGAGGCTGCCACAGACAGG No data
1053105643_1053105647 -5 Left 1053105643 9:35405718-35405740 CCTGCCCGTCTTGGCAGAGGACT No data
Right 1053105647 9:35405736-35405758 GGACTGAGGCTGCCACAGACAGG No data
1053105640_1053105647 13 Left 1053105640 9:35405700-35405722 CCACTGGGGAGAGGTGTGCCTGC No data
Right 1053105647 9:35405736-35405758 GGACTGAGGCTGCCACAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053105647 Original CRISPR GGACTGAGGCTGCCACAGAC AGG Intergenic
No off target data available for this crispr