ID: 1053115873

View in Genome Browser
Species Human (GRCh38)
Location 9:35501692-35501714
Sequence GAACCATGGTTGGCTGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 77}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053115873 Original CRISPR GAACCATGGTTGGCTGCTAC TGG (reversed) Intronic
906573263 1:46862703-46862725 GCACCAGTGTTGGCTGCTCCAGG - Intergenic
906972149 1:50526792-50526814 GAACCCTCATTGGCTGCTAGTGG - Intronic
908651340 1:66336581-66336603 GAACAAAGGTTGGGTGCTGCTGG + Intronic
909480532 1:76125174-76125196 GAAACCTTGTTGGCTGCTCCTGG - Intronic
910401040 1:86838475-86838497 CCACCATGCTTGGCTTCTACTGG - Intergenic
910954011 1:92681896-92681918 GAAACATGGTAGGGTGCTAGGGG - Intronic
917039537 1:170789187-170789209 TAACCATGGTTTTCTGTTACGGG + Intergenic
917565371 1:176207233-176207255 GCGCCGGGGTTGGCTGCTACAGG - Exonic
920005686 1:202832225-202832247 CCACCATGCCTGGCTGCTACTGG - Intergenic
921372434 1:214438197-214438219 GAAGCCAGGTTGGCTGCCACAGG - Intronic
1063379218 10:5573971-5573993 GAACCCAGTTTGGCTGCTAGAGG - Intergenic
1064565529 10:16635474-16635496 GCAGCATGGTAGGCTGCTAAGGG - Intronic
1066652866 10:37675496-37675518 GATTCATGGTTGGCTGGAACCGG - Intergenic
1072295843 10:94008924-94008946 GAACCATGGATGGGTGCTAGAGG + Intronic
1075856222 10:125632288-125632310 GAACCAGGGTTGGTTTCTGCTGG - Intronic
1081758377 11:45560410-45560432 GGACCGTGCTTGGCTGCTGCAGG + Intergenic
1085051416 11:73382102-73382124 GAACCCTGGTGGGTTGCTCCAGG + Intronic
1085836638 11:79963517-79963539 GAACCATGGTGAGCTGCTGGGGG + Intergenic
1087011256 11:93516200-93516222 GAACCATGCTTGGCAGGTCCCGG + Intronic
1099122295 12:78706377-78706399 GAACAGTGGCTGGCTGTTACAGG - Intergenic
1104427592 12:128690918-128690940 GAACCATGGATGGCTACTCTGGG - Intronic
1106911455 13:34467608-34467630 CAGCTATGGTTGGCTGCTATTGG - Intergenic
1118775075 14:68968852-68968874 GTACCAGGGCTGGCTGCTGCTGG + Intronic
1120203412 14:81562760-81562782 GAATCCTGGTTGACTGCTAGTGG - Intergenic
1126112444 15:45183652-45183674 GGACCATGGGTGGGAGCTACTGG - Intronic
1130541940 15:84826756-84826778 GAAACATGGTTGGCTGCTCCAGG - Intronic
1133639357 16:7701916-7701938 GCACCCTGGTTTGCTGCAACAGG - Intronic
1136461214 16:30411367-30411389 GAAGAATTATTGGCTGCTACAGG + Intronic
1146528153 17:33584597-33584619 CAGCCCTGGTTGGCTGCTCCAGG - Intronic
1147412325 17:40262617-40262639 GAACCATCCTTGGCTCCCACAGG - Exonic
1155149759 18:23113693-23113715 GAACCAGGGATGGCTGGTTCTGG - Intergenic
1168288121 19:55344522-55344544 GAACCCTGGTTGCCAGCTGCTGG + Intronic
926363651 2:12113502-12113524 CAGCCATGGTTGGCTGCTTTTGG + Intergenic
926445697 2:12939501-12939523 TAAACATGGTAGGCTGCTTCTGG + Intergenic
928477827 2:31649072-31649094 GAAACATGGTTGGGTTCTAGAGG - Intergenic
928937478 2:36694202-36694224 TAACCATGATGAGCTGCTACTGG - Intergenic
930146112 2:48006263-48006285 GAACCCTGGTTGGCTGAGGCAGG + Intergenic
939072568 2:137560788-137560810 GACACATGGTGGGCTGCTAGGGG - Intronic
939987187 2:148841281-148841303 GAATCATGGTTGCCAGGTACTGG - Intergenic
940665873 2:156608906-156608928 GAAAATTGGTGGGCTGCTACTGG + Intronic
946032027 2:216712994-216713016 GGAACATTGTTGGATGCTACAGG - Intergenic
1170342535 20:15345483-15345505 GAATCAAGGCTGGCTCCTACTGG + Intronic
1174622812 20:51889346-51889368 AAACCTGTGTTGGCTGCTACTGG + Intergenic
1175060005 20:56233346-56233368 GCACCATGGTTGGCCACTATAGG + Intergenic
1182085577 22:27558869-27558891 GAACCATGATTGGGTCCCACTGG - Intergenic
1184079964 22:42212385-42212407 GAATCATGGGTTGCTGCTCCAGG + Exonic
949905517 3:8855369-8855391 GATCCATAGGTGGCAGCTACAGG - Intronic
966897418 3:184456302-184456324 AAACCTTGGTGGGCTGCTAGGGG + Intronic
967441945 3:189518237-189518259 GAACCAGGGTGAGCTGCTACGGG + Intergenic
975100405 4:70506713-70506735 GCACCATGCTTGGCTCCTAGTGG - Intergenic
977918964 4:102623284-102623306 GTAACCTGGTTGTCTGCTACTGG - Intergenic
982145464 4:152384496-152384518 GAATCATGGTTGTCTGAGACAGG + Intronic
987954427 5:24719633-24719655 GAAGTATGGTTGGCTACTACAGG - Intergenic
988535919 5:32068367-32068389 GATCCATGGCAGCCTGCTACAGG + Intronic
988879539 5:35486222-35486244 GAGCCATGGTTGGCAGGTCCAGG - Intergenic
994570435 5:101506998-101507020 GACCCATGGGTTGCTGCTGCTGG - Intergenic
994710055 5:103255870-103255892 GAACCATAGGTGGCAGCTCCAGG + Intergenic
996956833 5:129193346-129193368 TAACCAGGGGAGGCTGCTACTGG - Intergenic
997080376 5:130731659-130731681 CAACTCTGGTTGGTTGCTACTGG - Intergenic
1003630122 6:7779221-7779243 GCACCATGGTTGCCTGGCACTGG - Intronic
1003639648 6:7865842-7865864 GATCCCTGGTGGGCTGCTTCTGG - Intronic
1007460312 6:42013321-42013343 GAACCATGGTTAACTGCCATTGG + Intronic
1012325775 6:97915110-97915132 GAATCATGGTAGGCTACTCCGGG - Intergenic
1012389097 6:98716699-98716721 GTAGCATGTTTGGCTGCCACAGG - Intergenic
1013627275 6:111950747-111950769 AGAGCATGGTTGGCTGCTTCAGG + Intergenic
1015386580 6:132631620-132631642 CAGCCCTGGTTGGCTGATACAGG + Intergenic
1018411565 6:163554132-163554154 GAACCCTAGCTGGCTGCTTCTGG + Intronic
1020120757 7:5501951-5501973 TGAGCATGGCTGGCTGCTACTGG - Exonic
1020268662 7:6578586-6578608 GAACCATGTCCGGCAGCTACTGG + Exonic
1022474974 7:30704037-30704059 TGACCATGGTTGGTTGGTACAGG + Intronic
1023777309 7:43620140-43620162 GATCCATGGTTGAGTGCTTCTGG + Intronic
1041720058 8:60967603-60967625 GAACCATGTGTGGCTGCCTCTGG + Intergenic
1042704974 8:71656676-71656698 GAACCAAGATTAGCTTCTACAGG - Intergenic
1045421803 8:102023753-102023775 GAGCCCTGGTTGGCTGATAATGG - Intronic
1048423124 8:134296721-134296743 GAACCATGGTAGTCTGTTTCTGG - Intergenic
1053115873 9:35501692-35501714 GAACCATGGTTGGCTGCTACTGG - Intronic
1058091885 9:100814305-100814327 GCACCATGGATGGCTGCTAAAGG + Intergenic
1058321688 9:103639638-103639660 GTACTGTGGTTGGCTCCTACAGG + Intergenic
1186012725 X:5153977-5153999 GACCAATGTTTGGCTGCTGCTGG + Intergenic
1189990555 X:46589911-46589933 GAACTATTGCTGGCTGCTGCTGG - Intronic
1199044370 X:143151807-143151829 GATCCATTGATGGCTGTTACAGG + Intergenic
1199610601 X:149609703-149609725 GGAACATGGTTGGGTCCTACAGG - Intronic
1201612873 Y:15862510-15862532 GAACCATGTTTGTCTGGTGCAGG + Intergenic