ID: 1053118033

View in Genome Browser
Species Human (GRCh38)
Location 9:35522592-35522614
Sequence CTGTGTATAAGGAGCTATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053118033_1053118037 26 Left 1053118033 9:35522592-35522614 CCAGCATAGCTCCTTATACACAG 0: 1
1: 0
2: 0
3: 6
4: 160
Right 1053118037 9:35522641-35522663 TGATTGCTTGCTTGATTAATTGG No data
1053118033_1053118036 1 Left 1053118033 9:35522592-35522614 CCAGCATAGCTCCTTATACACAG 0: 1
1: 0
2: 0
3: 6
4: 160
Right 1053118036 9:35522616-35522638 AAGAATACAGTAGATGCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053118033 Original CRISPR CTGTGTATAAGGAGCTATGC TGG (reversed) Intronic
901727301 1:11251992-11252014 CTATGTATTAGGTGCTGTGCTGG + Intronic
907162501 1:52381565-52381587 CTGGGTATGAGGCCCTATGCTGG - Intronic
908781107 1:67691127-67691149 CTGTGGACAAGGGACTATGCTGG + Intergenic
909164012 1:72194287-72194309 CTTTGTATAAGGTACTATTCAGG + Intronic
910060167 1:83081434-83081456 CTCTGTAAAAGGAAATATGCTGG + Intergenic
911261382 1:95690400-95690422 CTATGTATAAGGAATTTTGCTGG - Intergenic
911295495 1:96109550-96109572 CTGTGTTTAAGGCACTATTCTGG + Intergenic
911323446 1:96441668-96441690 TTGTGTAGCAGGAGCAATGCAGG - Intergenic
916738884 1:167631080-167631102 CTGTGTGTATGGAGGTATGCTGG + Intronic
919131506 1:193456601-193456623 CTGTTTAGAAGCAGCTATGTGGG + Intergenic
921300591 1:213748022-213748044 CTGTGTATGAGGAGCCAGGTGGG + Intergenic
921786697 1:219239334-219239356 CTGTGTACCAGGACCTGTGCTGG - Intergenic
922618886 1:226978794-226978816 GGGTGTGTAAGGAGCTGTGCGGG - Intronic
1065660432 10:27999720-27999742 CGGTGTTTAAGGACCAATGCCGG + Intergenic
1067967870 10:50934207-50934229 CTGTGTATCAGTCACTATGCTGG - Intergenic
1069923327 10:71830963-71830985 CTGTGCCAAAGGAGCTATTCTGG + Intronic
1071929347 10:90449913-90449935 CTGTGTATATTGAGCTATTTGGG + Intergenic
1072801018 10:98392512-98392534 CTGTGTTCAAGGAGTTGTGCTGG - Exonic
1074288811 10:112122851-112122873 CTGTGTCTAAGGAGGTAGGAAGG + Intergenic
1074406406 10:113183668-113183690 CTGTGCACAAGGAGCAAGGCCGG - Intergenic
1075353511 10:121747707-121747729 ATGTGTATCAGGATCTAAGCAGG - Intronic
1079236274 11:18692943-18692965 TTGTGGGTAAGGGGCTATGCTGG + Intergenic
1081620816 11:44618352-44618374 CTGTGTACCAGGAGGTGTGCGGG + Exonic
1081677097 11:44976662-44976684 CATTGTATCAGGAGCTGTGCTGG + Intergenic
1084157160 11:67320003-67320025 CTGTGTACATGGAACTGTGCAGG + Intronic
1085406034 11:76262795-76262817 CTATGTATACGGAGAGATGCAGG - Intergenic
1086282987 11:85212359-85212381 CTCTTTATAAGAAGCTATGAAGG + Intronic
1086919758 11:92573101-92573123 CTGTGTTTTAGGACTTATGCAGG + Intronic
1088021560 11:105125710-105125732 CTGTGTAAAAGGAGATATTTTGG - Intergenic
1088169663 11:106981036-106981058 CTATGTTTGAGGAGATATGCTGG - Intronic
1088682709 11:112257753-112257775 CTGTGTATAAGTGGCTTGGCAGG - Intronic
1088743799 11:112787700-112787722 CTGTGAATTTGGAGCTATGATGG - Intergenic
1089781645 11:120877289-120877311 CTGTGTATCAGGTACCATGCTGG + Intronic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1094522580 12:31208570-31208592 GCGTGGATAAGGAGCTATACAGG - Intergenic
1099798813 12:87431603-87431625 CTTTGTATAAGGTGCTTTTCTGG + Intergenic
1099863170 12:88245042-88245064 CTGTGTACAAGGAGATCTGGTGG + Intergenic
1101395933 12:104347595-104347617 CTGTGTGCAAGGAGATGTGCTGG + Intronic
1104916833 12:132269804-132269826 CCGTGTCTAACCAGCTATGCAGG + Intronic
1111167953 13:84487612-84487634 CTGTGTTGAAAGAGCTTTGCTGG - Intergenic
1116852285 14:49920464-49920486 CTGGGTATAAGGAAGTATACTGG + Intergenic
1119572963 14:75692678-75692700 CTGTGTATGGGGAGCGAGGCAGG + Intronic
1119605477 14:76012573-76012595 CTGCTTTTCAGGAGCTATGCAGG + Intronic
1119784459 14:77301982-77302004 CTGTGTACCAGGTACTATGCGGG - Intronic
1123859200 15:24446276-24446298 CTGTGAACAAGGAGCTGTGTTGG - Intergenic
1123894732 15:24817321-24817343 CTGTGAATAGGCAGCTGTGCAGG - Intergenic
1126171679 15:45700441-45700463 CTGTGCATAATAAGATATGCTGG - Intergenic
1127795793 15:62437275-62437297 CAGTGTATTAGGAGTTATGGGGG + Intronic
1128667555 15:69549538-69549560 CCCTGCATAAGGAGCTATGGAGG + Intergenic
1128667754 15:69550987-69551009 CTGTCTATAAGCAGCTCTCCAGG - Intergenic
1129233652 15:74210663-74210685 CTGTGAGTAAGGAGCTGTGAAGG + Intronic
1129344805 15:74910388-74910410 CTGTGTCACAGGTGCTATGCTGG + Intergenic
1131613089 15:93985672-93985694 CTGTGTACAAGGAACTGTTCTGG + Intergenic
1131840529 15:96431804-96431826 CTGTCTATAAGGATCTCTGTTGG + Intergenic
1134188125 16:12100192-12100214 CTGTGTGTCAGGTGCTGTGCTGG + Intronic
1134229934 16:12420972-12420994 CTGTGTACTAGGTGCTATGCGGG + Intronic
1137499877 16:49002587-49002609 CTTTGTGTAAGGATCCATGCTGG - Intergenic
1137598964 16:49743465-49743487 CTGTGTACCAGGCCCTATGCTGG - Intronic
1139771364 16:69280250-69280272 CTGTGTATAAAGAGGTAGACAGG - Intronic
1140064000 16:71594457-71594479 CTTTGTACAAGGAACTTTGCAGG - Intergenic
1141047136 16:80725477-80725499 CTGTGGGCCAGGAGCTATGCTGG - Intronic
1141727844 16:85801335-85801357 CTGTGTATAAAGCCCTGTGCTGG + Intronic
1144391785 17:14800359-14800381 CTGTGAATAGGGAGCTGTGATGG + Intergenic
1146554879 17:33814765-33814787 GCCTGTATAAGGATCTATGCAGG + Intronic
1148515525 17:48213389-48213411 CTCTGTATAAGGGCCTTTGCAGG - Intronic
1150251821 17:63709734-63709756 CTCTGTATGAGGAGTTATGTAGG + Intronic
1151642578 17:75406789-75406811 CTGTGTGCAAGGGGCTCTGCAGG + Intergenic
1153524141 18:5979013-5979035 CTGTGTACCAGGTGCTGTGCCGG - Intronic
1154958915 18:21288314-21288336 CTCTGTGGAGGGAGCTATGCTGG + Intronic
1155316608 18:24578035-24578057 CTGTGGGAGAGGAGCTATGCGGG + Intergenic
1155424941 18:25697145-25697167 CTATGTATAAGGCGTTATGCTGG + Intergenic
1156195039 18:34765164-34765186 CTGGGCATCAGGAGCCATGCTGG + Intronic
1158399879 18:57112433-57112455 CAGTGTAGAAGGAGCAATGGTGG + Intergenic
1158958755 18:62569239-62569261 ATTTGTATAATGAGCAATGCAGG - Intronic
1165703165 19:37953941-37953963 CAGTGTACAAGGAGGTATACAGG - Intronic
925156827 2:1655081-1655103 CTGTGTATAATGTTCTATGTAGG - Intronic
925647894 2:6055698-6055720 TTGTTGATCAGGAGCTATGCTGG + Intergenic
925960258 2:9007365-9007387 CTATGTTCAAGGAGCTATGTGGG + Intergenic
929056833 2:37885582-37885604 CTATGTAGAAAGAGCTCTGCTGG - Intergenic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
936607744 2:113974977-113974999 CTATGTAGAAGAAGCTATTCCGG + Intergenic
938229440 2:129645881-129645903 CTGTGGACACGGAGCCATGCTGG - Intergenic
938229445 2:129645911-129645933 CTGTGGACACGGAGCCATGCTGG - Intergenic
938229450 2:129645941-129645963 CTGTGGACACGGAGCCATGCTGG - Intergenic
938229455 2:129645971-129645993 CTGTGGACACGGAGCCATGCTGG - Intergenic
938229460 2:129646001-129646023 CTGTGGACAAGGAGCCATGCTGG - Intergenic
938229470 2:129646061-129646083 CTGTGGACACGGAGCCATGCTGG - Intergenic
938229475 2:129646091-129646113 CTGTGGACACGGAGCCATGCTGG - Intergenic
938229480 2:129646121-129646143 CTGTGGACACGGAGCCATGCTGG - Intergenic
938229485 2:129646151-129646173 CTGTGGACACGGAGCCATGCTGG - Intergenic
938899717 2:135789790-135789812 CTGTGTTTGAGCAGCTGTGCAGG - Exonic
939529717 2:143342687-143342709 CTGTGTGTCAGAAACTATGCTGG + Intronic
939954885 2:148519468-148519490 CTGTGTACAGGGACCTGTGCTGG - Intergenic
942373123 2:175307840-175307862 ATCAGTATAAGAAGCTATGCTGG + Intergenic
942678110 2:178450228-178450250 CTGTGTATACAGACCTGTGCAGG + Exonic
943424967 2:187719807-187719829 CTCTGCATAAGGGGCTATGTTGG - Intergenic
945573697 2:211503604-211503626 CTGTGCCCAAGGCGCTATGCGGG - Intronic
946138404 2:217667115-217667137 CTGGGTAGAAGAAGCTATGAAGG - Intronic
948645787 2:239403041-239403063 CTGTGTATAAGGAGAAAGGTGGG + Intergenic
1169500370 20:6154397-6154419 CTTTGTAGAATGAGCTATGGAGG + Intergenic
1175620562 20:60443574-60443596 CTGTGTATGAGGCACGATGCTGG + Intergenic
1178428414 21:32498109-32498131 CTTTGTGTCAGGAGCTGTGCTGG + Intronic
1178597542 21:33968330-33968352 CTGTGTCTAAGGAGATACCCTGG + Intergenic
1183424489 22:37731917-37731939 CTGTGCCTGAGGAGCCATGCTGG - Intronic
949739011 3:7208508-7208530 CTGTGTATCAGGTTCTGTGCTGG + Intronic
950303115 3:11899006-11899028 CTCTGTGTCAGGTGCTATGCTGG + Intergenic
950923552 3:16717847-16717869 CTGTGTCTAAGGGGCAATGGGGG - Intergenic
951219158 3:20051352-20051374 CAGGGGAGAAGGAGCTATGCAGG - Intronic
953965605 3:47303287-47303309 CTGTGTATAATGAGCTTTAAAGG + Intronic
954028449 3:47801700-47801722 CTGTGTATCAGTTGCTAAGCTGG - Intergenic
956106415 3:65823399-65823421 CTATGTATTAGGAACTGTGCTGG - Intronic
956774821 3:72556289-72556311 CTGTGGACCAGGTGCTATGCTGG + Intergenic
960068072 3:113396877-113396899 TTGGTTATAAGGAACTATGCTGG - Intronic
965413529 3:168363206-168363228 CAATGTATAATGAGCTATTCTGG + Intergenic
966116885 3:176474677-176474699 CTTTGTAGAATGAGCTATGGAGG + Intergenic
967442828 3:189528591-189528613 CTATGAATAAGGAGCTAGACTGG - Intergenic
967457932 3:189711325-189711347 CTGTGTACAAGGTCCTGTGCTGG + Intronic
969459136 4:7318680-7318702 CTGTGGATAAGGGGCTGTGTGGG - Intronic
973661523 4:53112063-53112085 CTGTGGATACAGAGCTAGGCCGG + Intronic
975974028 4:80074389-80074411 CTGTGTAGCTGGAGCTTTGCAGG + Intronic
976521015 4:86026820-86026842 GTGTGTATAATAAACTATGCTGG - Intronic
976940538 4:90697081-90697103 CTGCGTGTAAGGAACTAAGCAGG + Intronic
980665341 4:135926108-135926130 CTGTGTATCATGATCCATGCTGG + Intergenic
984064758 4:175034180-175034202 CTTTGTTTAAGGTGCTTTGCTGG - Intergenic
986406000 5:7425461-7425483 CTGTGTATATGTACCCATGCAGG + Intronic
989716510 5:44468949-44468971 CTGTGTATAGGCAGCTATGTTGG + Intergenic
992322899 5:75631522-75631544 CTGTGCCTAAGGAGTTATTCAGG + Intronic
997891550 5:137681548-137681570 CTAAGTATGAGGAGCTCTGCAGG + Intronic
1003581008 6:7340928-7340950 GTATGTATAAGGAGCCAGGCCGG - Intronic
1005152643 6:22770586-22770608 CTGATTATTAGGACCTATGCAGG - Intergenic
1007288347 6:40764630-40764652 CAGTCTAGAAGGAGCTATGATGG - Intergenic
1008551087 6:52631457-52631479 CTCTGCATAAGGAACCATGCTGG - Intergenic
1008725420 6:54411872-54411894 CTGATTATATGGTGCTATGCAGG + Intergenic
1011868767 6:91865954-91865976 CTGTGTATCTGTAGCTAAGCTGG + Intergenic
1015047355 6:128791954-128791976 CTATATATCAGGAGCTATGAGGG - Intergenic
1015441543 6:133253122-133253144 CTGCTAACAAGGAGCTATGCAGG - Intronic
1017308639 6:152950723-152950745 CTATGCATAATGAACTATGCTGG - Intergenic
1019786231 7:2979376-2979398 CTGTGTGCAGGGAGCTATGAAGG + Intronic
1020169997 7:5837693-5837715 CTGGGTATAAAGAGCTGTGGTGG - Intergenic
1023131919 7:37011994-37012016 ATGTGTCTGAGCAGCTATGCCGG - Intronic
1029215002 7:98941618-98941640 CTTTGTGTAAGGAGCCATTCTGG + Intronic
1030930306 7:115515424-115515446 GTGTGTGTAAGAAGGTATGCAGG - Intergenic
1031547904 7:123072217-123072239 CTCTGTGCAAAGAGCTATGCTGG + Intergenic
1032469073 7:132164939-132164961 CTGTGTCTTTGGAGCTATGATGG + Intronic
1032966939 7:137108564-137108586 CTGAGAATGAGGAGATATGCAGG - Intergenic
1033240658 7:139676729-139676751 CTGTGTACAAGGAACTGTGTGGG - Intronic
1038590745 8:28835094-28835116 CTATGTGCAAGGTGCTATGCTGG - Intronic
1040684583 8:49856687-49856709 CTGTGGATAGGGTCCTATGCAGG - Intergenic
1042944962 8:74145263-74145285 CTGTGGATAAGGTGAGATGCAGG + Intergenic
1050390582 9:5139373-5139395 CTTTGTAGAAGGAGCAATGTAGG + Intronic
1050412899 9:5384809-5384831 CTGTGTGTGAGGGGCTATGCTGG - Intronic
1052231253 9:26156505-26156527 CTATGTATAAGGTGCTAGGTTGG - Intergenic
1053118033 9:35522592-35522614 CTGTGTATAAGGAGCTATGCTGG - Intronic
1056716936 9:89039238-89039260 CTGTGTGCTAGGAGCAATGCTGG - Intronic
1061218713 9:129236703-129236725 CTGTGTCTCAGGAACTGTGCTGG - Intergenic
1061514942 9:131083739-131083761 TTGTGTACAAGGAGCAAAGCAGG + Intronic
1185776168 X:2804608-2804630 CTCTCTGTAAGGAGCTATTCGGG + Intronic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187159407 X:16750488-16750510 ATGTGCATCAGGCGCTATGCTGG - Intronic
1192720345 X:73689656-73689678 CAGTTTATAGGTAGCTATGCAGG - Intergenic
1196990848 X:121327023-121327045 CTGTGGATTAGGGGCCATGCTGG + Intergenic
1197085023 X:122462261-122462283 CTGTGTACTAGAAGCTAGGCTGG - Intergenic
1201293833 Y:12447101-12447123 CTCTCTGTAAGGAGCTATTCAGG - Intergenic
1202272994 Y:23088428-23088450 CTGTCTAAAAGGAGGGATGCTGG - Intergenic
1202293032 Y:23332254-23332276 CTGTCTAAAAGGAGGGATGCTGG + Intergenic
1202425991 Y:24722172-24722194 CTGTCTAAAAGGAGGGATGCTGG - Intergenic
1202444798 Y:24947914-24947936 CTGTCTAAAAGGAGGGATGCTGG + Intergenic