ID: 1053123558

View in Genome Browser
Species Human (GRCh38)
Location 9:35562588-35562610
Sequence CACTGAGCCAAGGCATCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 202}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053123547_1053123558 30 Left 1053123547 9:35562535-35562557 CCGAAGAGGAAGCGGGCGCAGGG 0: 1
1: 0
2: 1
3: 17
4: 226
Right 1053123558 9:35562588-35562610 CACTGAGCCAAGGCATCCTGGGG 0: 1
1: 0
2: 1
3: 15
4: 202
1053123553_1053123558 0 Left 1053123553 9:35562565-35562587 CCAGTGAAGCCTGAGGATGGGGA 0: 1
1: 0
2: 1
3: 31
4: 273
Right 1053123558 9:35562588-35562610 CACTGAGCCAAGGCATCCTGGGG 0: 1
1: 0
2: 1
3: 15
4: 202
1053123554_1053123558 -9 Left 1053123554 9:35562574-35562596 CCTGAGGATGGGGACACTGAGCC 0: 1
1: 0
2: 1
3: 29
4: 293
Right 1053123558 9:35562588-35562610 CACTGAGCCAAGGCATCCTGGGG 0: 1
1: 0
2: 1
3: 15
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053123558 Original CRISPR CACTGAGCCAAGGCATCCTG GGG Intronic
900685033 1:3942869-3942891 CACTTTGCCAAGTCACCCTGAGG + Intergenic
901068701 1:6506731-6506753 CACTGAGCCGAGGCCCCCAGAGG + Intronic
902625451 1:17673676-17673698 CACTCAGACAAGGCATGCAGGGG - Intronic
905510026 1:38511826-38511848 CACTGCGCCAAGGAATCCCATGG - Intergenic
905935193 1:41817839-41817861 CACTCAGTCAAGGCAGCCTGTGG - Intronic
906528264 1:46508929-46508951 CCCTGAGCTGAGTCATCCTGGGG - Intronic
907213583 1:52843272-52843294 CACTGGGGCGAGGAATCCTGAGG - Intronic
908859654 1:68469455-68469477 CACTGAGCCCAGGGAGCTTGAGG - Intergenic
909887816 1:80964450-80964472 CACTGACCCCAGGAATCCTTAGG - Intergenic
911755495 1:101549288-101549310 CACAGAAGCAAGTCATCCTGGGG + Intergenic
912324197 1:108742474-108742496 CGCTGAGCCAAAGCATCAGGTGG + Exonic
912556472 1:110519859-110519881 CACTGAACCCAGGCAGGCTGGGG + Intergenic
912690394 1:111800633-111800655 CTCTGAGCCAATGCATCCATAGG - Intronic
912745998 1:112245992-112246014 CCTTGAGCCCAGGCAGCCTGTGG - Intergenic
919597121 1:199578123-199578145 CACAGAGCCAATGGATCTTGAGG - Intergenic
919897082 1:202015650-202015672 GACTGAGCCAAGGAGGCCTGGGG + Exonic
920285857 1:204879057-204879079 CACTGAGCCAAGCTAATCTGAGG + Intronic
924280157 1:242429047-242429069 CACAGAACCATGGCATCATGAGG - Intronic
1064096584 10:12428588-12428610 CACTGAGCCAGGGCAGCCCCGGG + Intronic
1064134133 10:12735964-12735986 CACTGAGCCAGTGAATACTGTGG + Intronic
1065823174 10:29545133-29545155 CACTGAGCCAAGAGAGCTTGAGG + Intronic
1067469910 10:46528578-46528600 CTCTGAGCCTGGGCAGCCTGAGG - Intergenic
1067719195 10:48714207-48714229 CACTGAGCAAGGACATCCAGTGG - Intronic
1068477900 10:57551635-57551657 CACTGAGACAAAGCTTCCAGAGG - Intergenic
1068918050 10:62454330-62454352 CTGTGTGCCAAGGAATCCTGGGG + Intronic
1072241320 10:93497757-93497779 CACAGAGGGAAGGCATGCTGAGG + Intronic
1075871619 10:125775328-125775350 CACTGTCCGAAGGCATTCTGTGG - Intronic
1078089952 11:8258860-8258882 CACTGAGCCCCGGCATCCAAAGG + Intronic
1078866483 11:15302582-15302604 CCCTCAGCCTAGGCAACCTGAGG - Intergenic
1079689796 11:23405199-23405221 CACTGAGCCCAGGTAGCCAGTGG - Intergenic
1080627583 11:34044512-34044534 CACTGAGCCCAGCCATCTTCTGG + Intergenic
1081758201 11:45559460-45559482 CTCTGAGCCAAGGCATCAGATGG + Intergenic
1081998029 11:47377275-47377297 CTCTGAGCCAGGGCATAGTGGGG + Intronic
1085036459 11:73303144-73303166 CACTGAGCTAATGCCTTCTGAGG - Intergenic
1090924450 11:131237095-131237117 CAAGGAGCAAAGGCATCCCGTGG - Intergenic
1095939262 12:47715582-47715604 CTCTGAGCCAAGGCACTCTCAGG + Intronic
1096044831 12:48553559-48553581 CTCTGAGACAAGGCTTCCAGAGG - Intergenic
1097236212 12:57541717-57541739 CACTGACCCAAGGCAGGCTGTGG + Intronic
1101410252 12:104461509-104461531 CTCTGTGCCAATGCAGCCTGGGG - Intronic
1101750377 12:107578559-107578581 CACTGAGCAAAGGAATGATGAGG + Intronic
1104965065 12:132505307-132505329 CACGGAGCCCAGGCATCCTTGGG + Intronic
1105967862 13:25400852-25400874 CACTGTCCCAAGGCCTTCTGTGG - Intronic
1106422632 13:29595987-29596009 CACCGCGCCACAGCATCCTGTGG + Intergenic
1109078938 13:57873198-57873220 CACTGTGTCAATGCATACTGAGG + Intergenic
1113857931 13:113458991-113459013 AACTGACCTAAGGCATCATGCGG + Intronic
1115379551 14:32720168-32720190 CACTGACTCAAGGCTTTCTGAGG + Intronic
1118360847 14:65055120-65055142 CACTGAGGCAGAGCATTCTGGGG - Intronic
1119569286 14:75655809-75655831 CATTGAGCTAAGGCATCCAGTGG + Intronic
1119592528 14:75903388-75903410 CACTGATCCATGGAAGCCTGTGG - Intronic
1120888355 14:89469646-89469668 CACTGGGGCAAGGCACCCAGAGG - Intronic
1122510472 14:102262936-102262958 CACTGAGCCAATTGTTCCTGGGG - Intronic
1124962418 15:34408870-34408892 CACTGAGACAAAACAACCTGTGG - Intronic
1124979042 15:34555092-34555114 CACTGAGACAAAACAACCTGTGG - Intronic
1126575566 15:50193090-50193112 CCCAGAGCCAACGCAGCCTGGGG - Intronic
1128107378 15:65054868-65054890 CACCGAGCCTAGGCTTCCTGGGG + Exonic
1128542034 15:68542997-68543019 CAGTAAACCAAGGCATCCCGAGG - Intergenic
1128695272 15:69757314-69757336 CACTGGGCCCAGGCATCCCCTGG + Intergenic
1130401611 15:83560271-83560293 GCCAGAGCCAAGGTATCCTGGGG - Intronic
1131174314 15:90200787-90200809 CACTTAGTCTAGGCACCCTGCGG - Intronic
1132032932 15:98453092-98453114 CTCTAAGCCTAGGCCTCCTGGGG + Intronic
1132677005 16:1125022-1125044 CACTGTTCCAGGGCTTCCTGTGG - Intergenic
1132995057 16:2818421-2818443 CATTGAGCCAAGGCCTCCAGGGG - Intronic
1135294534 16:21267793-21267815 CACTGAGCCCAGGGATGCGGAGG + Intronic
1139646388 16:68334154-68334176 CACCCAGCTGAGGCATCCTGAGG + Intronic
1141826405 16:86483810-86483832 CCCAGAGCCAAGTCATGCTGGGG + Intergenic
1143180593 17:4981851-4981873 CACAGAGCCATGGGGTCCTGAGG + Intronic
1143611684 17:8021475-8021497 CACTGTGCCCAGCCATCGTGAGG - Intergenic
1144225031 17:13136896-13136918 CACTGAGGCAGGACATCTTGAGG + Intergenic
1144310218 17:14006931-14006953 CACTGAGGCAAGGCATAGGGAGG + Intergenic
1145177482 17:20713533-20713555 CAGTGAGCTGAGGCAGCCTGGGG - Intergenic
1145908526 17:28529283-28529305 CACTGAGGCATGGAATCCTCTGG + Intronic
1146793534 17:35766074-35766096 AACTGAGCCAGGGGGTCCTGAGG + Intronic
1149388823 17:56169716-56169738 GACAGCGCCAAGCCATCCTGAGG + Intronic
1151138410 17:71969507-71969529 TACTGAGACAAGGAAACCTGTGG + Intergenic
1151844603 17:76643588-76643610 ACCTGAGCCAAGGCGTCCAGTGG - Exonic
1152572513 17:81127007-81127029 CACTGAGCCGAGGCTGTCTGTGG - Intronic
1152676696 17:81645035-81645057 CACTGGACCTAGGCAGCCTGAGG - Exonic
1154401509 18:14042940-14042962 CTCTGAGACAAGGCTTCCAGAGG - Intergenic
1154403293 18:14063465-14063487 CAATGTGCCAAAGGATCCTGTGG - Intronic
1156269141 18:35515084-35515106 ATCTGGGCCAAGGCAGCCTGTGG + Intergenic
1156520919 18:37721751-37721773 CACTGAGCCAGGCTGTCCTGAGG - Intergenic
1157576148 18:48745108-48745130 CACTGTGCCCAGCCAACCTGGGG + Intronic
1158328688 18:56337875-56337897 CCATGAGCCGAAGCATCCTGAGG + Intergenic
1160399436 18:78599257-78599279 CACTGAGGCATGGTATCCTTTGG - Intergenic
1161272441 19:3397561-3397583 GACTGAGACAAGGCAGCCTGGGG - Intronic
1162110640 19:8397922-8397944 CACTGAGCCAACCCACCCTCAGG + Intronic
1163152907 19:15425362-15425384 CACTGAGCCCAGGTAGCCAGTGG + Exonic
1164433552 19:28208793-28208815 CACTGTCCCAAGGCATCTTTGGG - Intergenic
1164702588 19:30296427-30296449 CAGTTGGCCAAGACATCCTGGGG + Intronic
1165752771 19:38270907-38270929 CGGTGGGCCAAGGCCTCCTGGGG - Intronic
1166061932 19:40331311-40331333 CACGTAGCCAAGTCACCCTGTGG + Intronic
1166684846 19:44790140-44790162 CTCTGAGCCAAGGCAACGTGGGG - Intronic
1166912777 19:46172283-46172305 CACTCACACAAGGCATTCTGTGG + Intergenic
1166922436 19:46238848-46238870 CACTCACACAAGGCATTCTGTGG - Intergenic
1166966647 19:46533241-46533263 CCCAGAGCCCAGGCCTCCTGCGG + Intronic
1168056287 19:53866993-53867015 GCCTCAGCCTAGGCATCCTGTGG + Intronic
925310347 2:2877349-2877371 CACAGTGCCAGGGCATCCTCAGG + Intergenic
925428951 2:3774530-3774552 CACTGAGACATGGGATGCTGGGG + Intronic
926177486 2:10608455-10608477 GACTGAGCCAAGGTTTCCTTTGG - Intronic
926699393 2:15793221-15793243 CACTGACCCTCAGCATCCTGGGG + Intergenic
927250810 2:20993484-20993506 CCCTGAGCCAAGTCCTACTGAGG - Intergenic
927883260 2:26703700-26703722 CACTGACCCAAGGCTCCTTGGGG - Intronic
929992842 2:46804083-46804105 CGCTGAGCCACAGCATCCTCCGG + Intergenic
932372901 2:71207810-71207832 CACTGAGCTAAGGAACTCTGTGG + Intronic
933779424 2:85791165-85791187 CCCTGAAGCCAGGCATCCTGAGG + Intergenic
934308946 2:91846689-91846711 CACTCAGACAAGACATACTGAGG + Intergenic
935351219 2:102153262-102153284 CACTGAGCCATGGCATCCCTAGG + Intronic
935381929 2:102461530-102461552 CACTGAGCAACGGCTTCCTCTGG + Intergenic
936025352 2:109027467-109027489 CATGGAGCCAAGGAAGCCTGTGG + Intergenic
936042095 2:109157880-109157902 CACAGAGAAAAGCCATCCTGAGG - Intronic
936644072 2:114348859-114348881 CACAGGGGCAAGGCTTCCTGAGG - Intergenic
938035043 2:128028198-128028220 CTCTGAGCCGCGGCGTCCTGTGG + Intergenic
939530767 2:143358227-143358249 CACGGAGCCAAGGCAGGCTTTGG + Intronic
942664156 2:178298831-178298853 CACTGAGTCAAGGCATTCTGAGG - Intronic
948579384 2:238973601-238973623 CACTGGTCAGAGGCATCCTGTGG - Intergenic
1169276520 20:4236827-4236849 CCATGAGCCAAGACATCCAGTGG + Intronic
1170446595 20:16434314-16434336 CATTGAGCCGAGTCCTCCTGTGG - Intronic
1174471277 20:50763002-50763024 ACATGAGCCAAGGCACCCTGGGG - Intergenic
1174536163 20:51253188-51253210 CCCTGAGCCCAGGCTTCTTGGGG - Intergenic
1174552577 20:51372574-51372596 CGCCCAGCCAAGGCAACCTGTGG - Intergenic
1175941620 20:62539975-62539997 CACTGTGCCAAGGGCTTCTGGGG + Intergenic
1176024335 20:62978202-62978224 GAGTGAGCCCAGGCATCCTCTGG + Intergenic
1176265079 20:64205043-64205065 CCCTGAGCCTGTGCATCCTGGGG - Exonic
1176297747 21:5083208-5083230 GACTGCGCACAGGCATCCTGGGG - Intergenic
1177344456 21:19852221-19852243 CTATGTGCCAAAGCATCCTGGGG - Intergenic
1178563780 21:33664216-33664238 CACTGAGTGAAAGCAACCTGAGG - Intronic
1179574405 21:42298783-42298805 GGCTGAGCAAAGCCATCCTGGGG - Intergenic
1179859282 21:44178741-44178763 GACTGCGCACAGGCATCCTGGGG + Intergenic
1180030673 21:45204714-45204736 CACTGAGCAAAGGCTTGTTGAGG - Exonic
1182084437 22:27551582-27551604 CACAGAGCAAAGACCTCCTGGGG + Intergenic
950435969 3:12980306-12980328 CCCTGAGCCAAGTCAGCCTTTGG + Intronic
950777804 3:15365403-15365425 TTCTGAGCCAAGGAATCCAGGGG - Intergenic
952705410 3:36372467-36372489 CACTGAGCCCAGCCTACCTGTGG + Intergenic
953018740 3:39100625-39100647 CCCTGGGCCCAGGGATCCTGAGG - Intronic
953071977 3:39529889-39529911 CACTGGGACAACGCACCCTGGGG + Intergenic
956814314 3:72894212-72894234 CCCAGAATCAAGGCATCCTGAGG + Intronic
959669738 3:108962620-108962642 CAGTGAGCCTAGGGAGCCTGTGG - Intronic
961243701 3:125433858-125433880 CTCTGCCCTAAGGCATCCTGGGG - Intergenic
961645182 3:128389076-128389098 CCCTGGGCCGAGGCAGCCTGCGG + Intronic
961781855 3:129325144-129325166 GACACTGCCAAGGCATCCTGGGG - Intergenic
962995413 3:140622929-140622951 CTCTGAGACAAAGCCTCCTGAGG + Intergenic
966806235 3:183809985-183810007 AAGTGAGCCAGGGCCTCCTGTGG + Intronic
967119913 3:186373701-186373723 TACTGTGCCAAGCCATCCTCTGG + Intergenic
967519185 3:190408317-190408339 CACAGAGCCAATGATTCCTGGGG - Exonic
968869868 4:3236389-3236411 CCCTGAGCCAAGGCAGCCCATGG - Intronic
969447763 4:7255378-7255400 CACTGAGCCCATTCATACTGAGG - Intronic
973719281 4:53706873-53706895 CCCAGAGCCAAGGCTACCTGTGG - Intronic
974525722 4:63047735-63047757 CACTGAGGCAGGGCTGCCTGAGG - Intergenic
975227599 4:71892175-71892197 CACTGGGACAAGGCTTCCAGGGG + Intergenic
975497695 4:75052729-75052751 CACTGTGCCAAGACATTCAGAGG + Intergenic
976280118 4:83318935-83318957 CTCTAAACCAAGGCATACTGGGG + Intronic
979971397 4:127140152-127140174 CACAGAGCCATGGCAGTCTGTGG - Intergenic
985477410 5:85950-85972 CTCTGAGCTCAGGCATCCTGTGG + Intergenic
986398981 5:7361091-7361113 CTCTGAGCCAAGGAATGCAGGGG + Intergenic
986787400 5:11127082-11127104 CAGGGAGCCATGGCATTCTGTGG + Intronic
986874917 5:12096053-12096075 CAATGAGTAAAGGCAGCCTGAGG - Intergenic
991963189 5:72065873-72065895 CACTGAGCCATGGAAACCTGAGG - Intergenic
991963220 5:72066006-72066028 CACTGCGCCCTGGCCTCCTGAGG - Intergenic
993344346 5:86763946-86763968 CTCTGAACCAAGGAATCCTATGG + Intergenic
999132665 5:149296416-149296438 CCCTGAGCCATAACATCCTGTGG + Intronic
999247353 5:150162250-150162272 CACCCAGCCAGGGCCTCCTGGGG - Intergenic
1004814846 6:19301772-19301794 CATTGACCCAAGGAATCATGTGG - Intergenic
1005258159 6:24026966-24026988 CACTGGGCAAAAGCAGCCTGAGG - Intergenic
1006938251 6:37733411-37733433 CTCTGTGCCAAGGTACCCTGGGG + Intergenic
1007312305 6:40956144-40956166 CCCTAAGACAAGGCATGCTGGGG + Intergenic
1013124443 6:107169830-107169852 CTCTGAGACAAGGCTTCCAGAGG - Intronic
1013301167 6:108806045-108806067 CACAGAGCCAGGCCAGCCTGGGG - Intergenic
1013359147 6:109377819-109377841 CACTGAAACAAGGCTTTCTGAGG + Intronic
1013375138 6:109507693-109507715 CACTGAGGCAGGGGGTCCTGTGG - Intronic
1015213086 6:130720165-130720187 CACTGTGCCTAGGCCTCATGGGG + Intergenic
1016178281 6:141108110-141108132 CACTGTACCAAGCTATCCTGGGG - Intergenic
1018895590 6:168014229-168014251 CAGTGAGGAAATGCATCCTGAGG + Intronic
1019168329 6:170114402-170114424 CTCTGTGCCCAGGCCTCCTGAGG + Intergenic
1019426909 7:982290-982312 CGCAGAGCCGAGGCAGCCTGAGG - Intergenic
1021537786 7:21724778-21724800 CACTGGGCCAGGTCATCCTGTGG + Intronic
1021537809 7:21724914-21724936 CACTGGGCCAGATCATCCTGTGG + Intronic
1021537823 7:21724980-21725002 CACTGGGCCAGGTCATCCTGTGG + Intronic
1023593133 7:41799896-41799918 CACTGAACAGAGGCATGCTGAGG + Intergenic
1024704016 7:51938198-51938220 CTCTGAGGCAATGAATCCTGGGG + Intergenic
1025056845 7:55772070-55772092 TACTCAGCAAAGGCACCCTGGGG + Intergenic
1026228549 7:68463484-68463506 CAGAGCGCCAAGGCATCCGGAGG + Intergenic
1028158222 7:87456534-87456556 CACTGAGTAAAAGCTTCCTGAGG + Intronic
1028801318 7:94969509-94969531 CACTGAGACAAAGCTTCCAGAGG - Intronic
1032478038 7:132225666-132225688 CACTCAGCCTGGGCAGCCTGTGG + Intronic
1034604392 7:152297586-152297608 CACTGAGGCAAGACTTTCTGTGG - Intronic
1035111689 7:156488026-156488048 CACTGAGCCCACGCTTCCTCAGG - Intergenic
1035582682 8:749810-749832 CCTGGAGCCAAGGTATCCTGGGG + Intergenic
1035921153 8:3677522-3677544 CGCTGAGCCCAGCCACCCTGGGG - Intronic
1036516183 8:9446660-9446682 CACTGAGACAAAGCTTCCAGAGG - Intergenic
1037654378 8:20870572-20870594 CCCAGAGCCAAGGCATCATGGGG - Intergenic
1039480001 8:37865606-37865628 CACTGAGCCCGGCCTTCCTGGGG + Intronic
1040295182 8:46145337-46145359 CCCTGTTTCAAGGCATCCTGGGG + Intergenic
1045928303 8:107596643-107596665 CACTGAGACAAAGCATCCAGAGG - Intergenic
1047241969 8:123099048-123099070 CACTTAGACAAGGCAGCATGGGG + Intronic
1047336271 8:123939686-123939708 CACTGAGGCCATGCATCCTATGG - Intronic
1048274869 8:133058563-133058585 CCCTGAGCCCAGGCAGGCTGGGG - Intronic
1048618113 8:136101684-136101706 TATTGAAGCAAGGCATCCTGTGG - Intergenic
1052342287 9:27375641-27375663 CACTCACCCCATGCATCCTGAGG + Intronic
1053123558 9:35562588-35562610 CACTGAGCCAAGGCATCCTGGGG + Intronic
1054456885 9:65436284-65436306 CACTGAGCTCAGTCAGCCTGGGG + Intergenic
1056896952 9:90559902-90559924 CCATGAGCCAAGGAATGCTGGGG - Intergenic
1057140821 9:92725899-92725921 CTCTGACCCCAGGCCTCCTGTGG + Intronic
1059308525 9:113373139-113373161 CACTGACCCCAGGCTTCCAGAGG + Intergenic
1060903019 9:127277959-127277981 CACTGAGCCAAGTACTGCTGGGG - Intronic
1061423057 9:130482556-130482578 CACTGTGAAATGGCATCCTGTGG + Intronic
1187056306 X:15744230-15744252 CACTGAGGCATGGCAGGCTGGGG - Intronic
1187857729 X:23653299-23653321 CACTGAGGCAAGTCACCCAGAGG - Intergenic
1188907316 X:35804250-35804272 CTCTGAGACAAGCCATCTTGAGG - Intergenic
1189104520 X:38221956-38221978 CACTGTACAAAGGCATCCAGAGG + Intronic
1190115791 X:47625678-47625700 CACTGAGCCAAGGCACTCCAAGG - Intronic
1191234128 X:58120451-58120473 GGCTGACCCAAGGCATTCTGAGG + Intergenic
1192814110 X:74573397-74573419 CACTGAGGCAATTCATCCAGAGG - Intergenic
1193086094 X:77448584-77448606 CACTGAGGCAAGGAGTCCAGAGG - Intronic
1194981837 X:100449600-100449622 CACTGAGTCTAGGCAACGTGGGG - Intergenic
1195701063 X:107706146-107706168 CACCGTGCAAAGGCATCTTGAGG - Intergenic
1196618318 X:117793051-117793073 CACTAAGCCATGGCCTCCTAAGG - Intergenic
1198959599 X:142170243-142170265 CCCTGAGCTAAGGCAGCTTGGGG - Intergenic
1201778729 Y:17695414-17695436 CTCTGAGCCAAAACATCCAGAGG - Intergenic
1201822827 Y:18210578-18210600 CTCTGAGCCAAAACATCCAGAGG + Intergenic