ID: 1053124904

View in Genome Browser
Species Human (GRCh38)
Location 9:35573014-35573036
Sequence ATGGAGAGACAGAAAGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053124898_1053124904 -8 Left 1053124898 9:35572999-35573021 CCATTACCAGAAGCTATGGAGAG No data
Right 1053124904 9:35573014-35573036 ATGGAGAGACAGAAAGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053124904 Original CRISPR ATGGAGAGACAGAAAGGGGG AGG Intergenic
No off target data available for this crispr