ID: 1053125298

View in Genome Browser
Species Human (GRCh38)
Location 9:35576164-35576186
Sequence ACCTGGGGGCACCAAGGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053125298_1053125311 18 Left 1053125298 9:35576164-35576186 CCACTCCCTTGGTGCCCCCAGGT No data
Right 1053125311 9:35576205-35576227 GGACCCTCATTGGCTGAAACAGG No data
1053125298_1053125307 -5 Left 1053125298 9:35576164-35576186 CCACTCCCTTGGTGCCCCCAGGT No data
Right 1053125307 9:35576182-35576204 CAGGTTTTTGGCATTTGGTGAGG No data
1053125298_1053125314 26 Left 1053125298 9:35576164-35576186 CCACTCCCTTGGTGCCCCCAGGT No data
Right 1053125314 9:35576213-35576235 ATTGGCTGAAACAGGCACTCTGG No data
1053125298_1053125308 -4 Left 1053125298 9:35576164-35576186 CCACTCCCTTGGTGCCCCCAGGT No data
Right 1053125308 9:35576183-35576205 AGGTTTTTGGCATTTGGTGAGGG No data
1053125298_1053125310 8 Left 1053125298 9:35576164-35576186 CCACTCCCTTGGTGCCCCCAGGT No data
Right 1053125310 9:35576195-35576217 TTTGGTGAGGGGACCCTCATTGG No data
1053125298_1053125309 -3 Left 1053125298 9:35576164-35576186 CCACTCCCTTGGTGCCCCCAGGT No data
Right 1053125309 9:35576184-35576206 GGTTTTTGGCATTTGGTGAGGGG No data
1053125298_1053125302 -10 Left 1053125298 9:35576164-35576186 CCACTCCCTTGGTGCCCCCAGGT No data
Right 1053125302 9:35576177-35576199 GCCCCCAGGTTTTTGGCATTTGG No data
1053125298_1053125315 27 Left 1053125298 9:35576164-35576186 CCACTCCCTTGGTGCCCCCAGGT No data
Right 1053125315 9:35576214-35576236 TTGGCTGAAACAGGCACTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053125298 Original CRISPR ACCTGGGGGCACCAAGGGAG TGG (reversed) Intergenic
No off target data available for this crispr