ID: 1053125299

View in Genome Browser
Species Human (GRCh38)
Location 9:35576169-35576191
Sequence CAAAAACCTGGGGGCACCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053125299_1053125314 21 Left 1053125299 9:35576169-35576191 CCCTTGGTGCCCCCAGGTTTTTG No data
Right 1053125314 9:35576213-35576235 ATTGGCTGAAACAGGCACTCTGG No data
1053125299_1053125308 -9 Left 1053125299 9:35576169-35576191 CCCTTGGTGCCCCCAGGTTTTTG No data
Right 1053125308 9:35576183-35576205 AGGTTTTTGGCATTTGGTGAGGG No data
1053125299_1053125311 13 Left 1053125299 9:35576169-35576191 CCCTTGGTGCCCCCAGGTTTTTG No data
Right 1053125311 9:35576205-35576227 GGACCCTCATTGGCTGAAACAGG No data
1053125299_1053125309 -8 Left 1053125299 9:35576169-35576191 CCCTTGGTGCCCCCAGGTTTTTG No data
Right 1053125309 9:35576184-35576206 GGTTTTTGGCATTTGGTGAGGGG No data
1053125299_1053125307 -10 Left 1053125299 9:35576169-35576191 CCCTTGGTGCCCCCAGGTTTTTG No data
Right 1053125307 9:35576182-35576204 CAGGTTTTTGGCATTTGGTGAGG No data
1053125299_1053125315 22 Left 1053125299 9:35576169-35576191 CCCTTGGTGCCCCCAGGTTTTTG No data
Right 1053125315 9:35576214-35576236 TTGGCTGAAACAGGCACTCTGGG No data
1053125299_1053125310 3 Left 1053125299 9:35576169-35576191 CCCTTGGTGCCCCCAGGTTTTTG No data
Right 1053125310 9:35576195-35576217 TTTGGTGAGGGGACCCTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053125299 Original CRISPR CAAAAACCTGGGGGCACCAA GGG (reversed) Intergenic
No off target data available for this crispr