ID: 1053125300

View in Genome Browser
Species Human (GRCh38)
Location 9:35576170-35576192
Sequence CCAAAAACCTGGGGGCACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053125300_1053125315 21 Left 1053125300 9:35576170-35576192 CCTTGGTGCCCCCAGGTTTTTGG No data
Right 1053125315 9:35576214-35576236 TTGGCTGAAACAGGCACTCTGGG No data
1053125300_1053125309 -9 Left 1053125300 9:35576170-35576192 CCTTGGTGCCCCCAGGTTTTTGG No data
Right 1053125309 9:35576184-35576206 GGTTTTTGGCATTTGGTGAGGGG No data
1053125300_1053125308 -10 Left 1053125300 9:35576170-35576192 CCTTGGTGCCCCCAGGTTTTTGG No data
Right 1053125308 9:35576183-35576205 AGGTTTTTGGCATTTGGTGAGGG No data
1053125300_1053125310 2 Left 1053125300 9:35576170-35576192 CCTTGGTGCCCCCAGGTTTTTGG No data
Right 1053125310 9:35576195-35576217 TTTGGTGAGGGGACCCTCATTGG No data
1053125300_1053125314 20 Left 1053125300 9:35576170-35576192 CCTTGGTGCCCCCAGGTTTTTGG No data
Right 1053125314 9:35576213-35576235 ATTGGCTGAAACAGGCACTCTGG No data
1053125300_1053125311 12 Left 1053125300 9:35576170-35576192 CCTTGGTGCCCCCAGGTTTTTGG No data
Right 1053125311 9:35576205-35576227 GGACCCTCATTGGCTGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053125300 Original CRISPR CCAAAAACCTGGGGGCACCA AGG (reversed) Intergenic
No off target data available for this crispr