ID: 1053125304

View in Genome Browser
Species Human (GRCh38)
Location 9:35576179-35576201
Sequence CACCAAATGCCAAAAACCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053125304_1053125311 3 Left 1053125304 9:35576179-35576201 CCCCAGGTTTTTGGCATTTGGTG No data
Right 1053125311 9:35576205-35576227 GGACCCTCATTGGCTGAAACAGG No data
1053125304_1053125316 25 Left 1053125304 9:35576179-35576201 CCCCAGGTTTTTGGCATTTGGTG No data
Right 1053125316 9:35576227-35576249 GCACTCTGGGTTTCCAGCATTGG No data
1053125304_1053125315 12 Left 1053125304 9:35576179-35576201 CCCCAGGTTTTTGGCATTTGGTG No data
Right 1053125315 9:35576214-35576236 TTGGCTGAAACAGGCACTCTGGG No data
1053125304_1053125314 11 Left 1053125304 9:35576179-35576201 CCCCAGGTTTTTGGCATTTGGTG No data
Right 1053125314 9:35576213-35576235 ATTGGCTGAAACAGGCACTCTGG No data
1053125304_1053125310 -7 Left 1053125304 9:35576179-35576201 CCCCAGGTTTTTGGCATTTGGTG No data
Right 1053125310 9:35576195-35576217 TTTGGTGAGGGGACCCTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053125304 Original CRISPR CACCAAATGCCAAAAACCTG GGG (reversed) Intergenic
No off target data available for this crispr