ID: 1053125306

View in Genome Browser
Species Human (GRCh38)
Location 9:35576181-35576203
Sequence CTCACCAAATGCCAAAAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053125306_1053125310 -9 Left 1053125306 9:35576181-35576203 CCAGGTTTTTGGCATTTGGTGAG No data
Right 1053125310 9:35576195-35576217 TTTGGTGAGGGGACCCTCATTGG No data
1053125306_1053125316 23 Left 1053125306 9:35576181-35576203 CCAGGTTTTTGGCATTTGGTGAG No data
Right 1053125316 9:35576227-35576249 GCACTCTGGGTTTCCAGCATTGG No data
1053125306_1053125314 9 Left 1053125306 9:35576181-35576203 CCAGGTTTTTGGCATTTGGTGAG No data
Right 1053125314 9:35576213-35576235 ATTGGCTGAAACAGGCACTCTGG No data
1053125306_1053125311 1 Left 1053125306 9:35576181-35576203 CCAGGTTTTTGGCATTTGGTGAG No data
Right 1053125311 9:35576205-35576227 GGACCCTCATTGGCTGAAACAGG No data
1053125306_1053125315 10 Left 1053125306 9:35576181-35576203 CCAGGTTTTTGGCATTTGGTGAG No data
Right 1053125315 9:35576214-35576236 TTGGCTGAAACAGGCACTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053125306 Original CRISPR CTCACCAAATGCCAAAAACC TGG (reversed) Intergenic
No off target data available for this crispr