ID: 1053125309

View in Genome Browser
Species Human (GRCh38)
Location 9:35576184-35576206
Sequence GGTTTTTGGCATTTGGTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053125293_1053125309 25 Left 1053125293 9:35576136-35576158 CCCAACTTGGTCTTGGGTTCACT No data
Right 1053125309 9:35576184-35576206 GGTTTTTGGCATTTGGTGAGGGG No data
1053125298_1053125309 -3 Left 1053125298 9:35576164-35576186 CCACTCCCTTGGTGCCCCCAGGT No data
Right 1053125309 9:35576184-35576206 GGTTTTTGGCATTTGGTGAGGGG No data
1053125300_1053125309 -9 Left 1053125300 9:35576170-35576192 CCTTGGTGCCCCCAGGTTTTTGG No data
Right 1053125309 9:35576184-35576206 GGTTTTTGGCATTTGGTGAGGGG No data
1053125292_1053125309 26 Left 1053125292 9:35576135-35576157 CCCCAACTTGGTCTTGGGTTCAC No data
Right 1053125309 9:35576184-35576206 GGTTTTTGGCATTTGGTGAGGGG No data
1053125299_1053125309 -8 Left 1053125299 9:35576169-35576191 CCCTTGGTGCCCCCAGGTTTTTG No data
Right 1053125309 9:35576184-35576206 GGTTTTTGGCATTTGGTGAGGGG No data
1053125294_1053125309 24 Left 1053125294 9:35576137-35576159 CCAACTTGGTCTTGGGTTCACTG No data
Right 1053125309 9:35576184-35576206 GGTTTTTGGCATTTGGTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053125309 Original CRISPR GGTTTTTGGCATTTGGTGAG GGG Intergenic
No off target data available for this crispr