ID: 1053125310

View in Genome Browser
Species Human (GRCh38)
Location 9:35576195-35576217
Sequence TTTGGTGAGGGGACCCTCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053125299_1053125310 3 Left 1053125299 9:35576169-35576191 CCCTTGGTGCCCCCAGGTTTTTG No data
Right 1053125310 9:35576195-35576217 TTTGGTGAGGGGACCCTCATTGG No data
1053125303_1053125310 -6 Left 1053125303 9:35576178-35576200 CCCCCAGGTTTTTGGCATTTGGT No data
Right 1053125310 9:35576195-35576217 TTTGGTGAGGGGACCCTCATTGG No data
1053125298_1053125310 8 Left 1053125298 9:35576164-35576186 CCACTCCCTTGGTGCCCCCAGGT No data
Right 1053125310 9:35576195-35576217 TTTGGTGAGGGGACCCTCATTGG No data
1053125304_1053125310 -7 Left 1053125304 9:35576179-35576201 CCCCAGGTTTTTGGCATTTGGTG No data
Right 1053125310 9:35576195-35576217 TTTGGTGAGGGGACCCTCATTGG No data
1053125305_1053125310 -8 Left 1053125305 9:35576180-35576202 CCCAGGTTTTTGGCATTTGGTGA No data
Right 1053125310 9:35576195-35576217 TTTGGTGAGGGGACCCTCATTGG No data
1053125306_1053125310 -9 Left 1053125306 9:35576181-35576203 CCAGGTTTTTGGCATTTGGTGAG No data
Right 1053125310 9:35576195-35576217 TTTGGTGAGGGGACCCTCATTGG No data
1053125300_1053125310 2 Left 1053125300 9:35576170-35576192 CCTTGGTGCCCCCAGGTTTTTGG No data
Right 1053125310 9:35576195-35576217 TTTGGTGAGGGGACCCTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053125310 Original CRISPR TTTGGTGAGGGGACCCTCAT TGG Intergenic
No off target data available for this crispr