ID: 1053125316

View in Genome Browser
Species Human (GRCh38)
Location 9:35576227-35576249
Sequence GCACTCTGGGTTTCCAGCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053125305_1053125316 24 Left 1053125305 9:35576180-35576202 CCCAGGTTTTTGGCATTTGGTGA No data
Right 1053125316 9:35576227-35576249 GCACTCTGGGTTTCCAGCATTGG No data
1053125313_1053125316 -5 Left 1053125313 9:35576209-35576231 CCTCATTGGCTGAAACAGGCACT No data
Right 1053125316 9:35576227-35576249 GCACTCTGGGTTTCCAGCATTGG No data
1053125304_1053125316 25 Left 1053125304 9:35576179-35576201 CCCCAGGTTTTTGGCATTTGGTG No data
Right 1053125316 9:35576227-35576249 GCACTCTGGGTTTCCAGCATTGG No data
1053125312_1053125316 -4 Left 1053125312 9:35576208-35576230 CCCTCATTGGCTGAAACAGGCAC No data
Right 1053125316 9:35576227-35576249 GCACTCTGGGTTTCCAGCATTGG No data
1053125303_1053125316 26 Left 1053125303 9:35576178-35576200 CCCCCAGGTTTTTGGCATTTGGT No data
Right 1053125316 9:35576227-35576249 GCACTCTGGGTTTCCAGCATTGG No data
1053125306_1053125316 23 Left 1053125306 9:35576181-35576203 CCAGGTTTTTGGCATTTGGTGAG No data
Right 1053125316 9:35576227-35576249 GCACTCTGGGTTTCCAGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053125316 Original CRISPR GCACTCTGGGTTTCCAGCAT TGG Intergenic
No off target data available for this crispr