ID: 1053128206

View in Genome Browser
Species Human (GRCh38)
Location 9:35599652-35599674
Sequence CAGGACAATCAGCTGCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053128197_1053128206 18 Left 1053128197 9:35599611-35599633 CCCCTCTAAGGCCCATAAAAGCC No data
Right 1053128206 9:35599652-35599674 CAGGACAATCAGCTGCAGAGAGG No data
1053128203_1053128206 -3 Left 1053128203 9:35599632-35599654 CCCAGGCTCTGAGCAGACGTCAG No data
Right 1053128206 9:35599652-35599674 CAGGACAATCAGCTGCAGAGAGG No data
1053128202_1053128206 6 Left 1053128202 9:35599623-35599645 CCATAAAAGCCCAGGCTCTGAGC No data
Right 1053128206 9:35599652-35599674 CAGGACAATCAGCTGCAGAGAGG No data
1053128201_1053128206 7 Left 1053128201 9:35599622-35599644 CCCATAAAAGCCCAGGCTCTGAG No data
Right 1053128206 9:35599652-35599674 CAGGACAATCAGCTGCAGAGAGG No data
1053128196_1053128206 21 Left 1053128196 9:35599608-35599630 CCTCCCCTCTAAGGCCCATAAAA No data
Right 1053128206 9:35599652-35599674 CAGGACAATCAGCTGCAGAGAGG No data
1053128204_1053128206 -4 Left 1053128204 9:35599633-35599655 CCAGGCTCTGAGCAGACGTCAGG No data
Right 1053128206 9:35599652-35599674 CAGGACAATCAGCTGCAGAGAGG No data
1053128199_1053128206 16 Left 1053128199 9:35599613-35599635 CCTCTAAGGCCCATAAAAGCCCA No data
Right 1053128206 9:35599652-35599674 CAGGACAATCAGCTGCAGAGAGG No data
1053128198_1053128206 17 Left 1053128198 9:35599612-35599634 CCCTCTAAGGCCCATAAAAGCCC No data
Right 1053128206 9:35599652-35599674 CAGGACAATCAGCTGCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053128206 Original CRISPR CAGGACAATCAGCTGCAGAG AGG Intergenic
No off target data available for this crispr