ID: 1053130767

View in Genome Browser
Species Human (GRCh38)
Location 9:35614039-35614061
Sequence CTGTATGGCCAAATGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053130762_1053130767 4 Left 1053130762 9:35614012-35614034 CCGCCTCAAAAAAAAAAAAAAAG 0: 256
1: 10417
2: 99967
3: 72650
4: 112665
Right 1053130767 9:35614039-35614061 CTGTATGGCCAAATGGAAGAGGG No data
1053130763_1053130767 1 Left 1053130763 9:35614015-35614037 CCTCAAAAAAAAAAAAAAAGAAA 0: 258
1: 6795
2: 22061
3: 29116
4: 68659
Right 1053130767 9:35614039-35614061 CTGTATGGCCAAATGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053130767 Original CRISPR CTGTATGGCCAAATGGAAGA GGG Intronic
No off target data available for this crispr