ID: 1053135987

View in Genome Browser
Species Human (GRCh38)
Location 9:35650528-35650550
Sequence TGTCCCAGTGGACCAGGGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 262}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053135987_1053135993 27 Left 1053135987 9:35650528-35650550 CCGGCCCCTGGTCCACTGGGACA 0: 1
1: 0
2: 0
3: 19
4: 262
Right 1053135993 9:35650578-35650600 GCAGCGTCACAGCCCCTAAGAGG 0: 1
1: 0
2: 1
3: 7
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053135987 Original CRISPR TGTCCCAGTGGACCAGGGGC CGG (reversed) Exonic
900151637 1:1181512-1181534 TGTCACAGGCAACCAGGGGCGGG - Intronic
900172271 1:1274752-1274774 TGTCCCAGAGGGCCAGAGTCAGG - Intergenic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900245590 1:1634713-1634735 GCTCTCGGTGGACCAGGGGCTGG - Intronic
900256819 1:1701870-1701892 GCTCTCGGTGGACCAGGGGCTGG - Intronic
900333535 1:2149202-2149224 TGGTACAGTGGCCCAGGGGCTGG + Intronic
900677717 1:3899416-3899438 TTTCACAGTGGACCCGGCGCGGG - Intronic
901639556 1:10686470-10686492 TTGCCCAGGGGACCAAGGGCTGG + Intronic
903300378 1:22374579-22374601 CGGCCCAGTGGCCCAGGGTCAGG + Intergenic
903362024 1:22782907-22782929 TGTGCGTGTGGAGCAGGGGCTGG - Intronic
903759609 1:25688862-25688884 TGTCCCAGTGAGCCTGTGGCAGG + Intronic
904408533 1:30311118-30311140 TGACACAGTGGACCCAGGGCAGG - Intergenic
905732773 1:40307816-40307838 TGTCTCAGAGGAACAGGGGTGGG - Intronic
905856819 1:41319958-41319980 TTCCCCAGTGGCCCAGAGGCAGG + Intergenic
906032453 1:42732528-42732550 GGTGCCAGTGGAGCAGGGGTGGG - Intergenic
906210045 1:44007715-44007737 TGTCCCAGATGAGCAGAGGCTGG - Intronic
906401407 1:45507502-45507524 TGACCCAGTGGACCAGTGTGTGG + Exonic
907600901 1:55768260-55768282 TGTTCCAGTGGTCCAGGGAGGGG - Intergenic
908814375 1:68016550-68016572 TTGCTCAGTGGACCAGGGACTGG - Intergenic
910432787 1:87175470-87175492 TTTCCGAGTGGACCTGGGGAGGG + Intergenic
911065118 1:93781107-93781129 AGGCCAAGTGGACTAGGGGCAGG - Intronic
912099872 1:106191912-106191934 AGTCCAAGTGTACCAGGGTCAGG + Intergenic
913089637 1:115467902-115467924 TTTCCCTGGGGACCTGGGGCAGG - Intergenic
913543550 1:119844440-119844462 TTTCTCACTGGACCAGGGGCCGG + Intergenic
915449322 1:155993817-155993839 AGTCCCAGAGTACCAGGGGCAGG + Intronic
919819665 1:201465230-201465252 TCTCCCAGGGTAGCAGGGGCAGG + Intergenic
921685090 1:218080931-218080953 TGTGCAAGTGAACCAGAGGCGGG + Intergenic
923772367 1:236948704-236948726 AGTCCCTGTGGAGCAGGTGCTGG - Intergenic
1062810423 10:459364-459386 TGTCCCAGAGGACACGGGACCGG + Intronic
1063385560 10:5614196-5614218 GGCCCTAGTGGAACAGGGGCAGG - Intergenic
1065952925 10:30668151-30668173 TGTCACGGTGGCCCAGGGCCAGG + Intergenic
1067728276 10:48790085-48790107 TGTGCCAGGGAACCAGGGTCGGG + Intronic
1067962888 10:50876336-50876358 TGTCCAAGTGGAGCACAGGCTGG - Intronic
1074317209 10:112370652-112370674 GGGCGCAGTGGAGCAGGGGCCGG - Intergenic
1076229595 10:128808998-128809020 TGTCCCAGCAGACCAGTGGGTGG - Intergenic
1076629226 10:131842470-131842492 TGTCCCTGTGGGGCAGGGACTGG - Intergenic
1077435120 11:2535240-2535262 GGTGAAAGTGGACCAGGGGCAGG + Intronic
1079133577 11:17763428-17763450 TCTCCCAGGGAACCAGGGTCTGG - Intronic
1080387648 11:31819226-31819248 TGTCCAGGTGTGCCAGGGGCGGG - Intronic
1080424931 11:32146623-32146645 TTCCCCAATTGACCAGGGGCTGG - Intergenic
1081437146 11:43039749-43039771 TGTCCCAGTTTGCCTGGGGCTGG - Intergenic
1081569148 11:44278811-44278833 TGTCCCTGAGGACCTGGGGAGGG + Intronic
1081582002 11:44359038-44359060 TTTCCCAGTGGAGGCGGGGCTGG - Intergenic
1083163195 11:60867994-60868016 TGATTCAGTGGACCTGGGGCAGG + Intronic
1083280031 11:61621101-61621123 TGGCACTGTGGACTAGGGGCTGG - Intergenic
1084266702 11:68008751-68008773 TGGCCCAGAGGCCCCGGGGCCGG + Intronic
1087137373 11:94734641-94734663 TCTCCCAGGGGAGCATGGGCAGG - Intronic
1088917552 11:114239000-114239022 TGTGCTAGGTGACCAGGGGCAGG - Intronic
1090386906 11:126362635-126362657 TGGCCCAGGGGAAGAGGGGCAGG + Intronic
1091254733 11:134173439-134173461 TGTCCGGGTGGGCCAGGGGCAGG - Intronic
1091403758 12:196482-196504 TGTCCCCGAGGCTCAGGGGCTGG + Intronic
1092530388 12:9339322-9339344 AGCCCCAGGGGAGCAGGGGCTGG + Intergenic
1094761515 12:33538419-33538441 TGTCCCATTGGTCCAGATGCAGG + Intergenic
1096672131 12:53206373-53206395 TCACCCAGTGAACTAGGGGCAGG + Intronic
1096717415 12:53499680-53499702 CGTCCCGGGGGGCCAGGGGCGGG - Intronic
1097725606 12:63072193-63072215 TGTCTCAGTAGGCAAGGGGCAGG + Intergenic
1097794013 12:63843796-63843818 TTTCCTAGCGGAGCAGGGGCGGG + Intergenic
1098256995 12:68626884-68626906 TGGCCCTGTGGACAAGTGGCGGG - Intronic
1101583206 12:106062284-106062306 TGTCCAAATTGACCAGGTGCTGG - Intergenic
1102001286 12:109559442-109559464 TGTACCACTGGACCTGGGTCTGG + Intronic
1102058654 12:109915596-109915618 AGGCCCAGGGGAGCAGGGGCCGG - Intronic
1104199072 12:126569950-126569972 TGTCCTAGTGGGCCAGGGGTGGG + Intergenic
1104380111 12:128299928-128299950 GGTGCCAGTGGAACCGGGGCAGG + Intronic
1105027732 12:132860557-132860579 TGTCACAGTGCCCCAGTGGCTGG + Intronic
1106303930 13:28494383-28494405 ATTCCCAGAGGACCTGGGGCAGG - Intronic
1106332587 13:28753234-28753256 TCTCTCTGTGGCCCAGGGGCTGG - Intergenic
1108435079 13:50393922-50393944 GGTCCACGTGGCCCAGGGGCTGG + Intronic
1108618263 13:52157214-52157236 TGGACCAGTGGAGGAGGGGCAGG + Intronic
1110642061 13:77836528-77836550 TGTCCCAGTGGAACCGAAGCAGG - Intergenic
1113255148 13:108497182-108497204 TGTCCCAGTGGATCTGTGGTTGG - Intergenic
1113567449 13:111327371-111327393 TGTTCCACTGGGACAGGGGCCGG - Intronic
1117721257 14:58631100-58631122 TGGCCCAGTAGAACAGGAGCAGG - Intergenic
1117985094 14:61379211-61379233 TTTCCAAGTGGACCTGGGGAGGG - Intronic
1118636529 14:67753255-67753277 TGTGGCACTGGAGCAGGGGCTGG - Intronic
1121573844 14:94967295-94967317 CGTCCCAGAGGGCCAGGGGGAGG - Intergenic
1122192967 14:100061972-100061994 TGTGCAAGTGGACCTGGGTCAGG + Intronic
1122444343 14:101758352-101758374 TGTCCCAGAGGAGCAGGGGTTGG + Intergenic
1122558027 14:102592036-102592058 TTTCCCAGGGGACGCGGGGCTGG - Intergenic
1122602417 14:102928343-102928365 CGTCCCAGGGGACTGGGGGCGGG + Intronic
1122609188 14:102969649-102969671 TGGCCAAGTGGGCAAGGGGCCGG - Intronic
1122634376 14:103123306-103123328 TGTCCCTGCGTCCCAGGGGCTGG - Intergenic
1122648361 14:103209970-103209992 TGGACCTGTGGAGCAGGGGCAGG + Intergenic
1122884089 14:104702899-104702921 TGGCCCTGTGGTCCAGGAGCAGG + Intronic
1123091561 14:105744379-105744401 GGTCCCAGCGGACCCTGGGCAGG - Intergenic
1202860617 14_GL000225v1_random:79207-79229 TGTCCCACTGGGCAAGGGCCCGG + Intergenic
1124202042 15:27686920-27686942 TGGCACACTGGACCAGGGGTAGG - Intergenic
1126121223 15:45253266-45253288 TGGCACAGTGAACCCGGGGCTGG + Exonic
1127811349 15:62568173-62568195 TGTCCCAGTGTGGCTGGGGCTGG + Intronic
1128025824 15:64435962-64435984 TGTCCTAGTGGACAAGGGCATGG - Intronic
1128254576 15:66187375-66187397 TGCCCCAGTGGACAGGGAGCTGG - Intronic
1129178191 15:73855109-73855131 TGTCCCAGAGGCCCACGGCCAGG + Intergenic
1130836064 15:87651315-87651337 TCTCCCAGTAGATAAGGGGCAGG + Intergenic
1132714652 16:1284688-1284710 GTTCCCAGGGGACAAGGGGCCGG + Intergenic
1134683287 16:16141515-16141537 TGTCTCAGGGCACCAGGGGCAGG - Exonic
1136172463 16:28497129-28497151 TGTCTCAGAGAACCAGGAGCTGG + Exonic
1138460047 16:57142691-57142713 TGTCCCAGTGGAGGGGGAGCTGG + Intronic
1138552378 16:57754765-57754787 GGTTCCAGAGGACCTGGGGCAGG - Intronic
1140126121 16:72120281-72120303 GGTCTGAGTGGACCAGGAGCTGG + Intronic
1140895131 16:79317850-79317872 TCTCCAAATGGAGCAGGGGCTGG - Intergenic
1141635846 16:85313415-85313437 TGTCCCGTTGGGCCAGGGCCAGG + Intergenic
1142142303 16:88478100-88478122 TGTGCCAGCGGGCCTGGGGCAGG - Intronic
1142352520 16:89586660-89586682 AGTCCCACTGGGCCTGGGGCAGG - Exonic
1143514185 17:7411242-7411264 TTTGGCAGTGGAGCAGGGGCAGG + Intronic
1143637782 17:8176278-8176300 TGTCCCCGAGGGCCATGGGCCGG - Exonic
1144946707 17:18973099-18973121 AGCCCCAGTGGGCAAGGGGCTGG + Intronic
1145939763 17:28737229-28737251 TATCCCAGGAGACCAGGGGCTGG + Intronic
1146905955 17:36618042-36618064 GGTCCCAGTGGAGCAGCAGCTGG + Intergenic
1147614695 17:41821061-41821083 TCTCCCCGTGGGCCAGGTGCGGG - Exonic
1147862774 17:43533289-43533311 TGTCCAAGGGCACCAGGGGCAGG + Exonic
1148199426 17:45740108-45740130 AGTCCCTGTGGAACAGGAGCGGG - Intergenic
1148335157 17:46835958-46835980 TCTCCCAGGGGCCCAGAGGCAGG - Intronic
1148895523 17:50836992-50837014 TGTCCCAGTTCATCAGGGACTGG + Intronic
1149554111 17:57560913-57560935 CGCCCCAGTGGAACTGGGGCAGG + Intronic
1151273478 17:73014919-73014941 TGAACCAGTGGCTCAGGGGCGGG - Intronic
1151382804 17:73737123-73737145 TGTCCAAGTGGACCAGGCCCTGG - Intergenic
1151561888 17:74874291-74874313 TGTCCCACTAGACCAGGAGTAGG + Intergenic
1151999281 17:77635262-77635284 GGTCACAGTGGCCCAGGAGCTGG + Intergenic
1152276725 17:79362427-79362449 TCACCCAGGGGACCAGGGGGTGG + Intronic
1152360441 17:79830896-79830918 TGTCCAAGAGGCCCTGGGGCAGG + Intergenic
1152597655 17:81245819-81245841 TGTCCCGGGGGGCCAGAGGCCGG - Exonic
1152855257 17:82662038-82662060 TTCCCCAGTGGGCCAGGGGCTGG + Intronic
1152923376 17:83076923-83076945 CCTCCCAGAGGACCAGGGGGAGG + Intergenic
1154361691 18:13668244-13668266 GGTTCCAGTGGTTCAGGGGCTGG - Intronic
1155118295 18:22792263-22792285 TGTTTCAGTGGACCTGGGGTGGG - Intergenic
1155219284 18:23669826-23669848 TGACCCAGTGGACAAGGCACAGG + Intergenic
1157761303 18:50267499-50267521 GGTCACAGTGGACCAGGGTCAGG + Intronic
1158531346 18:58265147-58265169 TGTCTCAGTGGGCCAGTGGGAGG + Intronic
1160228939 18:77032071-77032093 TGTCCCACTGGAGAAGGCGCCGG + Intronic
1160340152 18:78082720-78082742 TGCACCAGTGGACCTGGAGCTGG + Intergenic
1161008278 19:1947465-1947487 TGCTCCAGTGGTCCTGGGGCAGG + Intronic
1161226435 19:3148679-3148701 TGTTCTGGTAGACCAGGGGCCGG - Exonic
1161336150 19:3714711-3714733 TCCCCCAGTGGATCAGGGCCAGG - Intronic
1161430508 19:4229568-4229590 TGGCCCAGAGGACAAGGGCCAGG - Exonic
1163111328 19:15162435-15162457 ACACCCAGTGGACCAAGGGCTGG + Intronic
1163267885 19:16232663-16232685 GGTCCCCGTGCACCTGGGGCAGG - Intronic
1163861848 19:19747021-19747043 TGGCCCAGGGGAGGAGGGGCAGG - Intergenic
1164052169 19:21592866-21592888 TGACCCACTGGAGCCGGGGCTGG - Intergenic
1165423707 19:35734268-35734290 TGTCCCAGAGGCCCAGGGAAGGG + Intronic
1166313654 19:41976670-41976692 AGAGCCAGAGGACCAGGGGCTGG + Intronic
1166381730 19:42358363-42358385 TTTCCCAGTGCCCCAGGGACTGG + Intronic
1167409244 19:49335307-49335329 TGTCCCAGTGGAGCAGGTGAGGG + Intronic
1167566806 19:50261880-50261902 TGTCCTAGTGGGCCTGGGTCTGG + Intronic
1168332984 19:55580491-55580513 GGTCCCGGTGGAGGAGGGGCTGG + Intronic
925010827 2:484681-484703 TGTCCCAGTGCATCAGGGTGAGG + Intergenic
925915169 2:8599845-8599867 TGCCCCAGTGGACTTGGGTCTGG - Intergenic
926195906 2:10763424-10763446 TCTCCCTGTGGACCTTGGGCAGG + Intronic
927148084 2:20179944-20179966 TGGCCCAGTGGGGCAGGGCCAGG + Intergenic
929149663 2:38736170-38736192 TGTCTCAGTGGATCCAGGGCTGG - Intronic
929555766 2:42924779-42924801 TTTCCCAGTGGACAAGTGGCGGG + Intergenic
932796106 2:74697764-74697786 TGTTCCTTTGGGCCAGGGGCTGG + Intergenic
935411399 2:102768059-102768081 TGTACCAGTGGCGTAGGGGCAGG - Intronic
936687127 2:114840897-114840919 TGTGCCTGTGGAACAGAGGCAGG - Intronic
937161506 2:119766737-119766759 TGTTGCAGTGGTCCAGGGGAGGG + Intronic
938407270 2:131039591-131039613 TTTCCCAGGGGATCTGGGGCAGG - Intronic
938716752 2:134028178-134028200 TGTCCCAGGGGACGCGGGGTGGG + Intergenic
939505269 2:143038350-143038372 TCTCCCAGAGGAGCAGGGACAGG - Intronic
942387025 2:175453139-175453161 AGCCCCAGTGGGCAAGGGGCAGG + Intergenic
945116769 2:206415866-206415888 GGACCCACTGAACCAGGGGCAGG + Intergenic
947674003 2:231961392-231961414 TGGCCCAGTGGAGCAGAGCCTGG + Intronic
947791700 2:232872504-232872526 TGACCCAGGGAAGCAGGGGCTGG - Intronic
948530677 2:238601460-238601482 TTCCGCACTGGACCAGGGGCAGG - Intergenic
948787766 2:240361880-240361902 AGGCCCAGTGGAGCAGGTGCCGG + Intergenic
1173427317 20:42954400-42954422 TGTCCTCCTGGACCAGGGGAGGG - Intronic
1173465655 20:43279077-43279099 TGTCCCAGGCCCCCAGGGGCAGG + Intergenic
1174461969 20:50689708-50689730 TGTCCCAGTTTACCTGGGACTGG + Intronic
1174519638 20:51119579-51119601 TGTCCCAAAGGACTAGGGGAAGG - Intergenic
1175926085 20:62472292-62472314 GGTCCCAGTGGAGCAGGTGGTGG - Intronic
1177224151 21:18231965-18231987 TGTTCCAGTGAAACTGGGGCAGG - Intronic
1179441829 21:41400196-41400218 GGTGCCAGGGGACCAGGGGAGGG + Intronic
1180228767 21:46413882-46413904 CCACCCAGTGCACCAGGGGCAGG + Intronic
1180647042 22:17347835-17347857 GGTCCCAGTGGACGTGGTGCGGG - Intergenic
1181563266 22:23717745-23717767 GGTCCCAGAGGCCCAGGGTCAGG - Intergenic
1182101965 22:27663746-27663768 TCTCTCAGTGAACCAGGGGCAGG - Intergenic
1183540622 22:38427409-38427431 GGTCCCGCTGGTCCAGGGGCAGG + Exonic
1184654144 22:45932679-45932701 TGTCCACATGGACCAGGCGCTGG - Intronic
1184893422 22:47393251-47393273 TCACCCTGTGCACCAGGGGCTGG + Intergenic
950458636 3:13107742-13107764 AGACCCAGCGGCCCAGGGGCGGG - Intergenic
950680223 3:14580109-14580131 GGTCCCTGTGGGGCAGGGGCTGG + Intergenic
951719935 3:25687814-25687836 TGATTCAGTGGACCTGGGGCAGG - Intergenic
953983638 3:47425650-47425672 AGCCCCAGTGGGCCGGGGGCTGG - Intronic
954316569 3:49804672-49804694 TGTCCCCTAGTACCAGGGGCTGG - Exonic
956106739 3:65827124-65827146 AGTCCCAAGGAACCAGGGGCTGG + Intronic
956683045 3:71799359-71799381 AATCCCAGAGGACCAGGGGTAGG + Intergenic
956799389 3:72743268-72743290 TATCCCAGTGAATCAGGGCCAGG - Intergenic
959085031 3:101843143-101843165 TGTTGCAGTTGACCAGGTGCAGG + Intronic
959620450 3:108393963-108393985 TGGCGCAGTGGCCAAGGGGCAGG - Intronic
960342209 3:116487231-116487253 TGTCCATGAGGACCAGAGGCTGG + Intronic
961683085 3:128611901-128611923 TGGCCCAGTGGACCAGCTGCAGG + Intergenic
963042513 3:141080064-141080086 TGTCCCAGTGGAAAAGAGACTGG - Intronic
966935666 3:184707057-184707079 AGGCCCAGTGAACCACGGGCAGG - Intergenic
967915935 3:194578207-194578229 TGTCCCAGCCGAGCAGGGGCTGG - Intergenic
968570604 4:1338503-1338525 TGGCACAGTGGGCCATGGGCAGG - Exonic
968661087 4:1799116-1799138 GGTCCCACCAGACCAGGGGCTGG - Intronic
970491822 4:16582797-16582819 GGTCCCAGTGGAGCTGTGGCTGG - Intronic
975447246 4:74480329-74480351 TGCCCCAGTGGTCTAGGGGTAGG + Intergenic
979392114 4:120139744-120139766 TGGCCCAGTCATCCAGGGGCAGG + Intergenic
984829706 4:183961005-183961027 TGTCACAGAGAACCAGGGGTAGG - Intronic
985693556 5:1326973-1326995 TGTCCCTGTGGAGGAGGAGCTGG - Intronic
985693655 5:1327553-1327575 TGTCCCTGTAGAGCAGGAGCTGG - Intronic
989090362 5:37724063-37724085 TTTCCCGGGGGACCAGGGGAAGG - Intronic
992359779 5:76025247-76025269 TGTCCCACTGGAGCATAGGCAGG + Intergenic
992644984 5:78803542-78803564 GGCCCCAGTGGACCAAGGCCAGG - Intronic
996713659 5:126568477-126568499 TGTCCCAGGGGAGCAAGGGAAGG + Intronic
997702313 5:135911326-135911348 TGGGCCATTGAACCAGGGGCTGG + Intergenic
998882557 5:146658198-146658220 GGTCCCAGAGCACCAGGGTCAGG - Intronic
999772536 5:154786429-154786451 TGTCCCAGAGGACCATAGCCAGG - Intronic
1001000714 5:168004371-168004393 AATCCCAGTGGAACAGGGTCTGG + Intronic
1001476524 5:172054716-172054738 TGCCTCAGGGGACCAGGGCCTGG + Intronic
1002637880 5:180617141-180617163 TGTCCCAGAGGCTGAGGGGCAGG - Intronic
1002637893 5:180617191-180617213 TGTCCCAGAGGCTGAGGGGCAGG - Intronic
1002637906 5:180617241-180617263 TGTCCCAGAGGCTGAGGGGCAGG - Intronic
1002637941 5:180617391-180617413 TGTCCCAGAGGCTGAGGGGCAGG - Intronic
1002637954 5:180617441-180617463 TGTCCCAGAGGCTGAGGGGCAGG - Intronic
1002637967 5:180617491-180617513 TGTCCCAGAGGCTGAGGGGCAGG - Intronic
1002637980 5:180617541-180617563 TGTCCCAGAGGCTGAGGGGCAGG - Intronic
1002637993 5:180617591-180617613 TGTCCCAGAGGCTGAGGGGCAGG - Intronic
1002638006 5:180617641-180617663 TGTCCCAGAGGCTGAGGGGCAGG - Intronic
1002638019 5:180617691-180617713 TGTCCCAGAGGCTGAGGGGCAGG - Intronic
1002638044 5:180617791-180617813 TGTCCCAGAGGCTGAGGGGCAGG - Intronic
1002638058 5:180617842-180617864 TGTCCCAGAGGTTGAGGGGCAGG - Intronic
1002638083 5:180617943-180617965 TGTCCCAGAGGCTGAGGGGCAGG - Intronic
1002638107 5:180618043-180618065 TGTCCCAGAGGCTGAGGGGCAGG - Intronic
1002638121 5:180618094-180618116 TGTCCCAGAGGCTGAGGGGCAGG - Intronic
1002638134 5:180618144-180618166 TGTCCCAGAGGCTGAGGGGCAGG - Intronic
1002638147 5:180618194-180618216 TGTCCCAGAGGCTGAGGGGCAGG - Intronic
1002638161 5:180618245-180618267 TGTCCCAGAGGCTGAGGGGCAGG - Intronic
1002638174 5:180618295-180618317 TGTCCCAGAGGCTGAGGGGCAGG - Intronic
1002638188 5:180618346-180618368 TGTCCCAGAGGCTGAGGGGCAGG - Intronic
1002638213 5:180618446-180618468 TGTCCCAGAGGCTGAGGGGCAGG - Intronic
1003766557 6:9243472-9243494 TGACCAAGTGCACCTGGGGCTGG + Intergenic
1005889483 6:30125113-30125135 TGTACCGGTGGGCCAGGGACGGG + Intergenic
1007406043 6:41637064-41637086 TGTCCTAGTGCCCCAGGAGCCGG - Intronic
1007522141 6:42458910-42458932 AGTCCCAGTGATCCAGAGGCAGG + Intergenic
1007780104 6:44247743-44247765 AGTCCCGGTGGAGGAGGGGCGGG + Intronic
1009578250 6:65494923-65494945 AGTCCCAGTGGACAAGGTGATGG + Exonic
1010295698 6:74193985-74194007 AGTCCACGGGGACCAGGGGCTGG - Intergenic
1012053237 6:94370912-94370934 TGACCCAGTGGATCTGTGGCAGG - Intergenic
1012903684 6:105038395-105038417 CCTCCGAGTGGACCAGTGGCAGG + Intronic
1017276989 6:152581257-152581279 TGCCCTAGTGGGCCAGGGACTGG + Intronic
1018309726 6:162495422-162495444 TGACACAGTGGGCCAGTGGCTGG + Intronic
1018559730 6:165089171-165089193 AGTCCCAGGGCACCAGGAGCAGG - Intergenic
1018634479 6:165848739-165848761 TGTTCCAGAGGAACAGTGGCCGG + Intronic
1018742393 6:166740055-166740077 TGTCCCAGTGGGTGAGGAGCTGG + Intronic
1019478272 7:1254550-1254572 GGTCCCAGAGGACCAGGCTCTGG - Intergenic
1019570721 7:1710769-1710791 AGCAGCAGTGGACCAGGGGCTGG - Intronic
1020100571 7:5392049-5392071 CGGCCCAGTGGACCAGGGACAGG - Intronic
1022493301 7:30837219-30837241 GGTCACAGGGGACCAGGAGCAGG + Intronic
1023812142 7:43919796-43919818 TGACCCGGTGGGCCAAGGGCAGG - Intronic
1024305954 7:47929740-47929762 TGACCCAGTGGGTCAGGGGTGGG - Intronic
1027192154 7:76002972-76002994 TGAGCCACTGTACCAGGGGCTGG - Intronic
1028872724 7:95786804-95786826 TGTCACAGTGTAGCAGGGACTGG + Intronic
1032793103 7:135256915-135256937 TGTCCAAGTGGCTCTGGGGCAGG + Intronic
1034467791 7:151239962-151239984 TGTCCCATTGGCCCAGAGTCTGG + Intronic
1035074728 7:156169911-156169933 TGTCCCAGGCCACCAGGAGCAGG - Intergenic
1035340522 7:158157774-158157796 TCTCCCAGGGGAGCAGGCGCAGG - Intronic
1035828336 8:2668330-2668352 GGTCCCAGAGGACCGGGAGCAGG + Intergenic
1040948480 8:52910938-52910960 TTTCCCAGTTGATCTGGGGCTGG - Intergenic
1042982977 8:74551303-74551325 TCCTCCAGTGGAACAGGGGCAGG - Intergenic
1047796166 8:128257917-128257939 TGTCCCAGTTGAGAAGTGGCAGG + Intergenic
1049420161 8:142512920-142512942 TGCCCCAGTGCACGAGGGGGAGG + Intronic
1053019487 9:34685015-34685037 TCTCCCAAGGGGCCAGGGGCAGG - Intergenic
1053135987 9:35650528-35650550 TGTCCCAGTGGACCAGGGGCCGG - Exonic
1056794014 9:89644478-89644500 TGTCCCAGTGTACCATAGGTTGG - Intergenic
1060412337 9:123408103-123408125 TGGCCCAGGGTAGCAGGGGCTGG - Intronic
1060553790 9:124498223-124498245 TGGTCCAGTGGACCCTGGGCTGG - Intronic
1060667145 9:125438764-125438786 TGTGCCAGTGAGCCAGGGGCTGG + Exonic
1060895196 9:127212628-127212650 TGTCCTCGTGGACCAGGTACTGG + Exonic
1062375955 9:136262018-136262040 TGTCCCCATGGAGCAGGGGAGGG - Intergenic
1062478596 9:136741449-136741471 GGTCCCACGGGAGCAGGGGCGGG - Intronic
1062624594 9:137437031-137437053 GGGCACAGAGGACCAGGGGCTGG + Intronic
1185595094 X:1301493-1301515 TTTCCCAGTGGAGCAGAGGGAGG - Intronic
1186202775 X:7170990-7171012 TGGCCCATTGTACCAGGGGATGG - Intergenic
1190101894 X:47528235-47528257 TGTCACAGTGGCCCAGGGCCAGG + Intergenic
1191678286 X:63814839-63814861 TGTCTCACTGGAACACGGGCTGG + Intergenic
1191780901 X:64863998-64864020 TCTCCCGGTGGACCAGGTCCTGG - Intergenic
1192905178 X:75543885-75543907 TGTAGCACTGGACCAGGTGCTGG - Intergenic
1196108996 X:111926112-111926134 TGGCTCAGTGGAGCAGGGGGAGG + Intronic
1197093797 X:122571142-122571164 TGTCCCAGTGCCTCAGTGGCAGG - Intergenic
1197647708 X:129036042-129036064 TGTCTCAGTGGACCACATGCTGG + Intergenic
1200319910 X:155177263-155177285 TGTCCCACAGGACCTGTGGCTGG + Intergenic
1200747796 Y:6917654-6917676 TGTCACAGTGGACAATGGGGAGG + Intronic
1201178184 Y:11322389-11322411 TGTCCCACTGCACAAGGGCCCGG - Intergenic