ID: 1053140850

View in Genome Browser
Species Human (GRCh38)
Location 9:35681938-35681960
Sequence GACCCAGGCCCTGCTCATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 230}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053140845_1053140850 7 Left 1053140845 9:35681908-35681930 CCTGAAAAGGAAGTCCCAATGCA 0: 1
1: 0
2: 0
3: 13
4: 160
Right 1053140850 9:35681938-35681960 GACCCAGGCCCTGCTCATTCAGG 0: 1
1: 0
2: 0
3: 16
4: 230
1053140839_1053140850 21 Left 1053140839 9:35681894-35681916 CCATCCCAGTTTCCCCTGAAAAG 0: 1
1: 0
2: 1
3: 27
4: 294
Right 1053140850 9:35681938-35681960 GACCCAGGCCCTGCTCATTCAGG 0: 1
1: 0
2: 0
3: 16
4: 230
1053140836_1053140850 30 Left 1053140836 9:35681885-35681907 CCAGGCCCTCCATCCCAGTTTCC 0: 1
1: 0
2: 6
3: 45
4: 459
Right 1053140850 9:35681938-35681960 GACCCAGGCCCTGCTCATTCAGG 0: 1
1: 0
2: 0
3: 16
4: 230
1053140848_1053140850 -8 Left 1053140848 9:35681923-35681945 CCAATGCAGAGCAAGGACCCAGG 0: 1
1: 0
2: 1
3: 17
4: 234
Right 1053140850 9:35681938-35681960 GACCCAGGCCCTGCTCATTCAGG 0: 1
1: 0
2: 0
3: 16
4: 230
1053140844_1053140850 8 Left 1053140844 9:35681907-35681929 CCCTGAAAAGGAAGTCCCAATGC 0: 1
1: 0
2: 1
3: 16
4: 137
Right 1053140850 9:35681938-35681960 GACCCAGGCCCTGCTCATTCAGG 0: 1
1: 0
2: 0
3: 16
4: 230
1053140837_1053140850 25 Left 1053140837 9:35681890-35681912 CCCTCCATCCCAGTTTCCCCTGA 0: 1
1: 0
2: 2
3: 37
4: 392
Right 1053140850 9:35681938-35681960 GACCCAGGCCCTGCTCATTCAGG 0: 1
1: 0
2: 0
3: 16
4: 230
1053140841_1053140850 17 Left 1053140841 9:35681898-35681920 CCCAGTTTCCCCTGAAAAGGAAG 0: 1
1: 0
2: 1
3: 18
4: 242
Right 1053140850 9:35681938-35681960 GACCCAGGCCCTGCTCATTCAGG 0: 1
1: 0
2: 0
3: 16
4: 230
1053140847_1053140850 -7 Left 1053140847 9:35681922-35681944 CCCAATGCAGAGCAAGGACCCAG 0: 1
1: 1
2: 6
3: 78
4: 615
Right 1053140850 9:35681938-35681960 GACCCAGGCCCTGCTCATTCAGG 0: 1
1: 0
2: 0
3: 16
4: 230
1053140838_1053140850 24 Left 1053140838 9:35681891-35681913 CCTCCATCCCAGTTTCCCCTGAA 0: 1
1: 0
2: 1
3: 28
4: 335
Right 1053140850 9:35681938-35681960 GACCCAGGCCCTGCTCATTCAGG 0: 1
1: 0
2: 0
3: 16
4: 230
1053140843_1053140850 9 Left 1053140843 9:35681906-35681928 CCCCTGAAAAGGAAGTCCCAATG 0: 1
1: 0
2: 0
3: 15
4: 162
Right 1053140850 9:35681938-35681960 GACCCAGGCCCTGCTCATTCAGG 0: 1
1: 0
2: 0
3: 16
4: 230
1053140842_1053140850 16 Left 1053140842 9:35681899-35681921 CCAGTTTCCCCTGAAAAGGAAGT 0: 1
1: 0
2: 0
3: 21
4: 214
Right 1053140850 9:35681938-35681960 GACCCAGGCCCTGCTCATTCAGG 0: 1
1: 0
2: 0
3: 16
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053140850 Original CRISPR GACCCAGGCCCTGCTCATTC AGG Intergenic
901163322 1:7197350-7197372 GCCACAGGTCTTGCTCATTCGGG - Intronic
901163409 1:7197937-7197959 GCCACAGGTCTTGCTCATTCGGG - Intronic
901218044 1:7565613-7565635 GAGCCAGGTCCTGCTCCTTTGGG + Intronic
904079437 1:27862760-27862782 GACTCAGGCCCTAGTTATTCTGG + Intergenic
904130579 1:28272610-28272632 GTCCCTGGCCGAGCTCATTCAGG + Exonic
904132855 1:28288244-28288266 GTCCCAGCCCCTGCTCATGCTGG + Intergenic
904392224 1:30193467-30193489 GACCCAGGGCCCAGTCATTCTGG + Intergenic
904474291 1:30754995-30755017 CCCCCAGGCCCTGCCCTTTCTGG + Intronic
904574038 1:31491141-31491163 GACCCAGGCATTGGTCAGTCAGG - Intergenic
905733645 1:40312296-40312318 GACCCAGGGCCAGCCCACTCTGG - Intronic
907473003 1:54686332-54686354 GCTCCTGGCCCTGCTCATTCAGG + Exonic
907513374 1:54978810-54978832 CACCCAGGCCCAGCCCCTTCTGG + Intergenic
912448981 1:109758200-109758222 GGCCCAGGCCCTGGCCATCCTGG + Intronic
918127091 1:181593897-181593919 GGCTCAGCCCCAGCTCATTCAGG - Intronic
918635027 1:186764895-186764917 TACCCCTGCCCTGCTCATTCTGG - Intergenic
921120231 1:212130026-212130048 GGCCAAGGCTCTGCTCACTCTGG + Intergenic
922227741 1:223660273-223660295 GCACCAGGGCCTGCTCATGCTGG + Intronic
1063469853 10:6275499-6275521 CACCCAGGCGCTGCTCTTGCTGG + Intergenic
1063733362 10:8724081-8724103 GAGCCAGGCCCTGCTGATGGTGG + Intergenic
1063932633 10:11044266-11044288 GACCAAGCCCCTGCTGTTTCGGG - Intronic
1065098122 10:22302871-22302893 CACCCTGGCCTTGCTAATTCAGG + Intergenic
1066393569 10:34998149-34998171 TAGCCCAGCCCTGCTCATTCAGG + Intergenic
1066745590 10:38602603-38602625 GCCACAGGCCCTGGGCATTCAGG - Intergenic
1067107107 10:43373758-43373780 GACCCTGGCCCTTCTCCTACTGG + Exonic
1067180693 10:43983608-43983630 GACCCAGGCCCCGCTGCTGCTGG - Intergenic
1070336095 10:75456197-75456219 AACGCAGGCCCTGCTCAGCCTGG - Intronic
1070681010 10:78448943-78448965 GCCGCAGGCACTCCTCATTCGGG + Intergenic
1070747065 10:78940112-78940134 GTGCCAGGCTCTGCTCATGCTGG - Intergenic
1071279644 10:84088774-84088796 AACACATGCCCTGCTCATGCAGG - Intergenic
1071555765 10:86600169-86600191 GACCCTGGCCCTGCTTTTGCAGG - Intergenic
1072720887 10:97780473-97780495 GCCCCAGGGCCTGCTCTTTGTGG + Intergenic
1073482227 10:103793628-103793650 GACCCATGCTCAGCACATTCTGG + Intronic
1075703491 10:124484283-124484305 GTCGCAGGCCTTGCTCCTTCAGG - Exonic
1075731073 10:124637191-124637213 GACCCAGCCCCTGCTCAGAATGG - Intronic
1076190995 10:128483391-128483413 ACCCCAGGCCCTGCTCACTGCGG - Intergenic
1076530234 10:131140231-131140253 GACCCAGCCCCTGCACAGCCAGG + Intronic
1076628094 10:131834167-131834189 GTCCCAGGCCCTGCTCCCTGAGG + Intergenic
1077016829 11:401840-401862 GACCCCGGCCCCGCTCACCCCGG + Intronic
1077016861 11:401910-401932 GACCCCGGCCCCGCTCACCCCGG + Intronic
1077016905 11:402003-402025 GACCCCGGCCCCGCTCACCCCGG + Intronic
1077016937 11:402073-402095 GACCCCGGCCCCGCTCACCCCGG + Intronic
1077016999 11:402212-402234 GACCCCGGCCCCGCTCACCCCGG + Intronic
1077017031 11:402282-402304 GACCCCGGCCCCGCTCACCCCGG + Intronic
1077017075 11:402375-402397 GACCCCGGCCCCGCTCACCCCGG + Intronic
1077017107 11:402445-402467 GACCCCGGCCCCGCTCACCCCGG + Intronic
1077460037 11:2704464-2704486 GACCCAGAGCCTGCCCATCCTGG - Intronic
1079149041 11:17881642-17881664 GTCCCAGGTCCTCCTCTTTCTGG + Intronic
1079720856 11:23812082-23812104 CACAAAGACCCTGCTCATTCAGG - Intergenic
1080005004 11:27397394-27397416 GACCTAGTCCCTGCTCATGAGGG - Intronic
1082784915 11:57311482-57311504 CACCCTGGCCCTGCTCCCTCCGG + Intronic
1083381551 11:62273506-62273528 GGCCCAGGCCCTGCACATCTCGG - Intergenic
1083481799 11:62953343-62953365 GAGCCATGCCCTAATCATTCTGG - Intronic
1083890664 11:65594247-65594269 AGCCCAGGCCCTGCCCCTTCTGG + Intronic
1085277459 11:75309248-75309270 GGCCCAAGCCCTGCTCCCTCAGG + Intronic
1085792849 11:79510886-79510908 GAGACAGGCCGTGCTAATTCTGG - Intergenic
1086431007 11:86737005-86737027 GCCGCAGTCCTTGCTCATTCAGG + Intergenic
1089296972 11:117475387-117475409 GACCCAGGCCCTGCAACATCTGG + Intronic
1089454937 11:118620688-118620710 GACCAAGGCACTGCCCTTTCCGG - Intronic
1089642674 11:119858065-119858087 GAGCCAGGCCCTCCTCATACCGG - Intergenic
1089678299 11:120105353-120105375 GAGCCAGACCCTGCTACTTCAGG + Intergenic
1092527625 12:9318825-9318847 TATCCAGGCCCTGCTCACCCAGG + Intergenic
1094834205 12:34314628-34314650 GACCCAGGCCCCGCTCCTCTGGG + Intergenic
1096534438 12:52262348-52262370 GCCCCCTGCCCTGCTCTTTCAGG + Intronic
1099908235 12:88797687-88797709 AACCCATGCCCTGTTGATTCTGG + Intergenic
1106451797 13:29888944-29888966 GACCCTGGCCCTGGTCAGTCCGG + Intergenic
1106625031 13:31411395-31411417 GTCCTGGTCCCTGCTCATTCTGG - Intergenic
1108252492 13:48581296-48581318 GACCCAGGCATTGCTCCTTTAGG + Intergenic
1111028420 13:82565407-82565429 GACCCCGCCCCCGCTCATTGTGG - Intergenic
1115886563 14:37978254-37978276 AACCCATGCACTGCTCAATCTGG - Intronic
1116330517 14:43591920-43591942 GACCCAAGCCCTGCAGACTCTGG + Intergenic
1116826279 14:49676646-49676668 GACCCAGGCACTGCGCACTGAGG + Intronic
1117524141 14:56580120-56580142 GACGCAGACCCTGCCCGTTCTGG - Intronic
1121439563 14:93940176-93940198 GAGCCAGACCCTGCTCTCTCTGG + Intronic
1122292975 14:100689351-100689373 GACCCAAGCCCTGCTGAACCAGG + Intergenic
1122692614 14:103538406-103538428 GTGCCAGCCCCTGCCCATTCAGG + Intergenic
1122789780 14:104179340-104179362 GACCCAGGGCCGGCTGATGCTGG + Exonic
1123067391 14:105625532-105625554 ACCCCAGGCCCTGCGCATACAGG - Intergenic
1128536788 15:68497666-68497688 CACCCAGGCCTTGCACTTTCAGG + Intergenic
1129216920 15:74105723-74105745 GACGCAGGCTTTGCACATTCTGG - Intronic
1129606327 15:77026837-77026859 GACCCCGGCCCTGCTATTTTGGG + Intronic
1129775501 15:78233787-78233809 GGCCCAGGCCCTGTCCATCCAGG - Intronic
1132676916 16:1124731-1124753 CACCCAGGCCCTGACCCTTCCGG + Intergenic
1135561877 16:23483004-23483026 GAACCAAGCTCTGCTCTTTCAGG - Exonic
1135947419 16:26877262-26877284 AATCCAGCCCCTGCTCAGTCTGG - Intergenic
1136024259 16:27459928-27459950 GACCAGGGCCCTGGTCACTCTGG - Intronic
1136112855 16:28075704-28075726 GACCCAGGCCCTGCTCACCGTGG - Intergenic
1136234499 16:28905529-28905551 GAGCCAGGCCCAGCTCAGTGTGG - Intronic
1136737474 16:32477046-32477068 GCCACAGGCCCTGGGCATTCAGG + Intergenic
1139750711 16:69107397-69107419 GGACCAGGCCCTGCTCTTCCTGG - Intronic
1141070522 16:80950421-80950443 CACCCAAGCCCATCTCATTCGGG + Intergenic
1142153952 16:88524780-88524802 GGCCGAGCCCCTGCTCACTCTGG - Intronic
1142373130 16:89694025-89694047 GCCCCAGGCCCTGCAGATCCAGG - Intronic
1203015597 16_KI270728v1_random:352531-352553 GCCACAGGCCCTGGGCATTCAGG - Intergenic
1203033932 16_KI270728v1_random:625689-625711 GCCACAGGCCCTGGGCATTCAGG - Intergenic
1143500883 17:7337910-7337932 GTGCCAGGCCCTGGGCATTCAGG + Intronic
1145766033 17:27458745-27458767 AACCCAGGCCCTGCCTTTTCAGG - Intronic
1145907046 17:28521896-28521918 TGCCCAGGCCATGCTCTTTCCGG - Intronic
1146744169 17:35313603-35313625 GACCCTGGTCCAGCCCATTCCGG - Intergenic
1147314692 17:39614036-39614058 GGCCCAGGCCCTCCTCCTCCGGG + Intergenic
1150209307 17:63433558-63433580 CACCCAGGCTCTGCTCAGGCTGG - Exonic
1151443496 17:74148617-74148639 CGCCCAAGCCCTCCTCATTCAGG - Intergenic
1152420825 17:80192116-80192138 CACGCAGGCTGTGCTCATTCTGG + Intronic
1152425220 17:80214888-80214910 GACCCAGGCCCAGATCCTTTGGG + Intronic
1203170583 17_GL000205v2_random:145046-145068 GGGCCAGGCCCTGCACATGCTGG - Intergenic
1153139240 18:1953772-1953794 GATCCAGGCACTGCACAGTCAGG + Intergenic
1154038670 18:10832796-10832818 GACCCGGGCCATGGACATTCCGG + Intronic
1158557264 18:58485737-58485759 GACGCAGGGCCTGCTCCGTCAGG + Intronic
1159393091 18:67820469-67820491 GACCCAGTTGCTGCTCCTTCGGG + Intergenic
1160691156 19:461142-461164 GACCCCGGCCCTCCTCGTCCCGG + Intergenic
1162155070 19:8671946-8671968 GACCCAGGCCCAGCCCTTTGTGG + Intergenic
1162399038 19:10433579-10433601 CACCCAGCCCCTGCTCACACAGG + Intronic
1162724241 19:12680409-12680431 ACCCCAGGCCCTGCACATTCAGG + Intronic
1164836463 19:31358030-31358052 GAACCAGGCCCAGCTCTTCCTGG + Intergenic
1165824664 19:38698882-38698904 GTCGCCAGCCCTGCTCATTCAGG - Intronic
1166634945 19:44442925-44442947 GATCCAGGCCTTTTTCATTCCGG + Exonic
1166675595 19:44738847-44738869 GCCCCCTGCCCTGCTCATTCGGG - Intergenic
1167749495 19:51371248-51371270 GACCCAGGCCCTGCCCAGCAGGG - Intergenic
925205717 2:2003820-2003842 GCCCCAGGCCCGGCTGCTTCAGG + Intronic
927682908 2:25151868-25151890 GTGCCAGGCCCTGCTCACTGAGG - Intronic
928167426 2:28981356-28981378 CACCCAGCCCCTGCTCAGACAGG + Exonic
928455770 2:31420212-31420234 AAGCCAGCCCCTGCACATTCAGG - Intergenic
933609078 2:84415505-84415527 GTCCCAGGCCCTTCACATCCTGG + Intergenic
934307991 2:91841794-91841816 GCCACAGGCCCTGGGCATTCAGG - Intergenic
934659241 2:96134353-96134375 GGCCCAAGCCCTTCTGATTCAGG - Intronic
936092859 2:109512187-109512209 GACCCTGGCCCTCCTCCTGCTGG + Intergenic
936093888 2:109517309-109517331 GTCCCAGGCCCCGCACAGTCCGG - Intergenic
937405085 2:121620243-121620265 GCCACTGGCCCTGCTAATTCTGG - Intronic
937436780 2:121887789-121887811 TTCCCAGGCCCTGCGCCTTCTGG - Intergenic
937904542 2:127046427-127046449 GATCCTGGCCCTGCTCCCTCTGG + Intergenic
941240418 2:163029462-163029484 GACCAGGGCCCTGCTACTTCAGG - Intergenic
944286152 2:197952081-197952103 CACCCAGGCTGTTCTCATTCAGG - Intronic
946308493 2:218869880-218869902 GAACCAAGCCCTGCGCATTAGGG - Intronic
1168768320 20:397189-397211 GACCCAAGCCCAGCTCACTCTGG + Exonic
1169980076 20:11374918-11374940 GTGCCAGGCACTGGTCATTCTGG - Intergenic
1171012253 20:21515098-21515120 GACCCTGGCCCTGCTGCCTCTGG + Intergenic
1172910336 20:38404313-38404335 GCCCCATGCCCTCTTCATTCTGG + Intergenic
1173273783 20:41560353-41560375 GACTCCTGCCCTGCTCATTCAGG + Intronic
1176179071 20:63741168-63741190 GACCCTGGCCCTGCTCCTGGCGG + Intronic
1176326568 21:5506876-5506898 GGGCCAGGCCCTGCGCATGCTGG - Intergenic
1176331138 21:5549329-5549351 GGGCCAGGCCCTGCGCATGCTGG + Intergenic
1176396619 21:6271622-6271644 GGGCCAGGCCCTGCGCATGCTGG - Intergenic
1176401189 21:6314075-6314097 GGGCCAGGCCCTGCGCATGCTGG + Intergenic
1176412256 21:6455378-6455400 CACCCAGCCCCAGCTCCTTCGGG + Intergenic
1176435968 21:6675029-6675051 GGGCCAGGCCCTGCGCATGCTGG - Intergenic
1176440538 21:6717482-6717504 GGGCCAGGCCCTGCGCATGCTGG + Intergenic
1176460230 21:7002099-7002121 GGGCCAGGCCCTGCGCATGCTGG - Intergenic
1176464800 21:7044551-7044573 GGGCCAGGCCCTGCGCATGCTGG + Intergenic
1176483791 21:7383877-7383899 GGGCCAGGCCCTGCGCATGCTGG - Intergenic
1176488361 21:7426330-7426352 GGGCCAGGCCCTGCGCATGCTGG + Intergenic
1178692338 21:34760384-34760406 GTGCCAGGCACTGCTTATTCTGG - Intergenic
1179261107 21:39758647-39758669 GACCCAGGCCTTGCACACACAGG - Intronic
1179687750 21:43063700-43063722 CACCCAGCCCCAGCTCCTTCGGG + Intronic
1179979282 21:44888014-44888036 GACACTGGCCCTGCTTCTTCAGG - Intronic
1180179706 21:46112448-46112470 CCCGCAGGCCCTGCTCCTTCAGG - Exonic
1180260239 21:46663420-46663442 GACCCAGTCCCTGTCCATACAGG + Exonic
1180535073 22:16388877-16388899 GCCACAGGCCCTGGGCATTCAGG - Intergenic
1181910884 22:26237300-26237322 GACCTGGTCCCTGCTCATTGTGG - Intronic
1182555022 22:31124515-31124537 CACCCACACCCTGCCCATTCGGG - Intronic
1182947795 22:34340946-34340968 GACCCAGGAGTTTCTCATTCTGG + Intergenic
1183184110 22:36282113-36282135 GGCCCAGGGCCTGCTCCTTCTGG + Exonic
1183219689 22:36504633-36504655 GACCCAGGATCAGCACATTCTGG + Exonic
1184231413 22:43160174-43160196 GGCCCAGGCCCTGCCCAGCCAGG + Intronic
1184970429 22:48016141-48016163 GCCCCAGGCCCTGCAGTTTCGGG - Intergenic
1185091773 22:48779554-48779576 GACCCAGTCCCCGCACAGTCCGG - Intronic
950408074 3:12816882-12816904 GGCCGAGGCACTGCACATTCTGG + Exonic
950488187 3:13285208-13285230 GGCCCACTCCCTGCTCCTTCCGG + Intergenic
954440306 3:50518155-50518177 GGCCCTGGCCCAGCTCATCCTGG + Intergenic
955228599 3:57079886-57079908 GACCCAGGCCCCTCACTTTCAGG - Intergenic
957781693 3:84826536-84826558 TCCCCAGGCCCTGCTGAGTCAGG + Intergenic
961447247 3:126986639-126986661 GAGCCAGGCCCTGCTCTCACAGG + Intergenic
961491650 3:127260621-127260643 GTCCCAGGCCCTGCCCACCCAGG - Intergenic
964090069 3:152865321-152865343 CCACCAGGCCCTGCCCATTCTGG - Intergenic
964471659 3:157063510-157063532 GACCTAGGACCTCCTCATTGGGG + Intergenic
966911633 3:184562960-184562982 GACCCAAGCCCTGCTCTAGCAGG - Intronic
969008920 4:4044819-4044841 GACCCTTGCCCTGCTCAACCAGG - Intergenic
970353717 4:15231918-15231940 GACTCAGGGTCTGCTCATTTGGG + Intergenic
972833363 4:42839282-42839304 TTCACAGGCCCTGCTCACTCTGG + Intergenic
975663479 4:76710169-76710191 GACCCAGGCCATGCAGATACTGG + Exonic
984760616 4:183359795-183359817 TGCCCAGGGCCTTCTCATTCTGG - Intergenic
985020716 4:185686757-185686779 GACCCTGGATCTTCTCATTCTGG - Intronic
985793581 5:1945901-1945923 GACCCACCACCTGCTCATTGAGG + Intergenic
991963417 5:72067875-72067897 AGCCCACGCCCTGCTCATACAGG - Intergenic
995752011 5:115461812-115461834 GAAACAGACACTGCTCATTCTGG + Intergenic
997704129 5:135930663-135930685 GAGCCAGGCCCCGCTCACCCCGG - Intronic
998108346 5:139482443-139482465 GACTCAGGCCCAGCTCATCAGGG - Intronic
998285982 5:140861368-140861390 GACCCAGGTCCTGCGCAATAGGG - Intronic
999996972 5:157101674-157101696 GACCCAGTCCTTACTCCTTCAGG + Intronic
1001451059 5:171824715-171824737 GAGCCAGGCCTTGCTTAGTCAGG + Intergenic
1002406997 5:179042503-179042525 GACCCAGGGCCTGCTGGATCAGG + Intergenic
1003414792 6:5898137-5898159 GGCCCAGGTCCTGCTCATAGTGG - Intergenic
1003426411 6:6000858-6000880 GGTCCAGGCCCTACTCATTTGGG - Intronic
1004516589 6:16326831-16326853 CACACAGCCCCTGCTCATCCCGG - Exonic
1004531708 6:16460543-16460565 GTACCAGGCGCTACTCATTCAGG + Intronic
1005243403 6:23855722-23855744 TACCCAGGCCCTGCCCCGTCTGG + Intergenic
1006111689 6:31750569-31750591 GACTCACGCCCTGCTCGTACTGG - Intronic
1007109720 6:39306023-39306045 GACCCAGTCCCTGCTCTTGAGGG - Intronic
1008056138 6:46947867-46947889 AACCCAGTCCCTGCTCAGGCTGG + Intronic
1010404379 6:75486342-75486364 GCCCCAGGCCTAGCTCATCCAGG + Intronic
1012661563 6:101902228-101902250 ATCCTAGGGCCTGCTCATTCTGG - Intronic
1016040922 6:139431248-139431270 AACTCAGGCCCAGCTTATTCTGG - Intergenic
1018392237 6:163349534-163349556 CACCCAGGCCCTGGTCTCTCTGG + Intergenic
1018849487 6:167576758-167576780 AACCCCGGCCCTGCCCATGCAGG + Intergenic
1019181880 6:170192521-170192543 AACCCAGGCCCTGCTCTCTTGGG + Intergenic
1019550157 7:1598188-1598210 GAGCCAGCCCCTGCTCCCTCTGG + Intergenic
1020179879 7:5913928-5913950 GAATGAGGCCCTGCTCATTCTGG + Intronic
1020303056 7:6810956-6810978 GAATGAGGCCCTGCTCATTCTGG - Intronic
1021798702 7:24283971-24283993 GTCCCAGGCCCCGCTTCTTCAGG + Intergenic
1022289052 7:28983852-28983874 CACACAGGACCCGCTCATTCGGG + Intergenic
1023836864 7:44073657-44073679 GCCACAGGCCCTTCTCCTTCCGG + Exonic
1025818920 7:64945503-64945525 TACCCAGGCCCTGCCCCCTCTGG + Intergenic
1027116483 7:75485820-75485842 CACCCAGGCCCTTCTCGCTCCGG + Intronic
1027121774 7:75527521-75527543 CACCCAGGCCCTTCTCGCTCTGG + Intergenic
1027275343 7:76549883-76549905 CACCCAGGCCCTTCTCGCTCCGG - Intergenic
1029579509 7:101426199-101426221 CACCCAGGCTCTGCTCGCTCAGG - Intronic
1029721054 7:102364433-102364455 CACCCAGGCCCTTCTCGCTCCGG - Intronic
1030953092 7:115817187-115817209 GACACAGACCCTGTACATTCTGG + Intergenic
1032715392 7:134504962-134504984 GCCCCAGGCTCTGCTGATTTGGG + Intergenic
1034956639 7:155339190-155339212 GACTCAGTCCCGGCTCAGTCTGG + Intergenic
1035173490 7:157033863-157033885 AGCCCAGGCTCTGCTCTTTCAGG - Intergenic
1039518593 8:38152975-38152997 GGCCCAGGCCCTGCTCCCTGTGG + Intergenic
1039916185 8:41862018-41862040 GCACCAGGCCCTGCTCAGACGGG + Intronic
1042480962 8:69301894-69301916 GACCCAGGCCCTCATTACTCTGG - Intergenic
1046946466 8:119978698-119978720 GACCCAGGCTCTCCTTATGCAGG + Intronic
1048651589 8:136484400-136484422 GACCCACGCCCTTCAAATTCAGG + Intergenic
1049045064 8:140143283-140143305 GATCTGTGCCCTGCTCATTCAGG + Intronic
1049246052 8:141563183-141563205 GACCCAGGCCTTGCTCATCAGGG + Intergenic
1049354781 8:142182319-142182341 GGCCCAGGCCCTGACCTTTCAGG - Intergenic
1049469426 8:142768868-142768890 GCTCCACCCCCTGCTCATTCAGG + Intronic
1049573115 8:143378713-143378735 GCTCCAGGCCCGACTCATTCCGG - Exonic
1052972402 9:34385122-34385144 GACCTAGGCCCTGCTTTTTGGGG - Intronic
1053140850 9:35681938-35681960 GACCCAGGCCCTGCTCATTCAGG + Intergenic
1055021977 9:71679863-71679885 GACCCAGGCGCTCCTCCCTCAGG + Intergenic
1055667528 9:78567533-78567555 GTTCCAGACCCTGCTCTTTCTGG - Intergenic
1056806856 9:89735754-89735776 TTCAGAGGCCCTGCTCATTCCGG + Intergenic
1057255184 9:93540634-93540656 GCACCAGGCCAGGCTCATTCAGG + Intronic
1060039452 9:120287121-120287143 GACACAGGCCCTGCTGACCCAGG + Intergenic
1061147390 9:128807998-128808020 GACCCAGGCCATGCCCACTGGGG + Exonic
1062309542 9:135928637-135928659 GATCCAGGCCCTTGTCATTCAGG + Intergenic
1203430963 Un_GL000195v1:90997-91019 GGGCCAGGCCCTGCGCATGCTGG - Intergenic
1203435548 Un_GL000195v1:133630-133652 GGGCCAGGCCCTGCGCATGCTGG + Intergenic
1186079575 X:5916009-5916031 TCCCCAGGACCTGCTCATTTGGG + Intronic
1187798936 X:23038041-23038063 TACCTTGGCCCTCCTCATTCAGG - Intergenic
1192215564 X:69155942-69155964 GCCCAAGGCTCTGCTCAGTCAGG - Intergenic
1192361718 X:70445032-70445054 GCCCCAGGCCCCGCTCAGCCCGG + Exonic
1199678779 X:150210264-150210286 GACCCAGGCTGTGCTCATTAGGG + Intergenic
1200111194 X:153741728-153741750 GCCACAGGCCCTGGGCATTCAGG - Intronic
1201903757 Y:19068757-19068779 GACCCAGGCCCTGCTTTGACTGG - Intergenic