ID: 1053142706

View in Genome Browser
Species Human (GRCh38)
Location 9:35691045-35691067
Sequence CGGAGCCGGGTCGTGGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 166}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053142689_1053142706 21 Left 1053142689 9:35691001-35691023 CCGGGGCGAGGTGCCTTCTCCCA 0: 1
1: 0
2: 0
3: 17
4: 186
Right 1053142706 9:35691045-35691067 CGGAGCCGGGTCGTGGGGTCTGG 0: 1
1: 0
2: 0
3: 7
4: 166
1053142697_1053142706 -8 Left 1053142697 9:35691030-35691052 CCGCCAAACCAGCGCCGGAGCCG 0: 1
1: 0
2: 0
3: 9
4: 63
Right 1053142706 9:35691045-35691067 CGGAGCCGGGTCGTGGGGTCTGG 0: 1
1: 0
2: 0
3: 7
4: 166
1053142693_1053142706 1 Left 1053142693 9:35691021-35691043 CCACCCAGGCCGCCAAACCAGCG 0: 1
1: 0
2: 1
3: 57
4: 778
Right 1053142706 9:35691045-35691067 CGGAGCCGGGTCGTGGGGTCTGG 0: 1
1: 0
2: 0
3: 7
4: 166
1053142691_1053142706 8 Left 1053142691 9:35691014-35691036 CCTTCTCCCACCCAGGCCGCCAA 0: 1
1: 0
2: 2
3: 48
4: 480
Right 1053142706 9:35691045-35691067 CGGAGCCGGGTCGTGGGGTCTGG 0: 1
1: 0
2: 0
3: 7
4: 166
1053142692_1053142706 2 Left 1053142692 9:35691020-35691042 CCCACCCAGGCCGCCAAACCAGC 0: 1
1: 0
2: 0
3: 64
4: 468
Right 1053142706 9:35691045-35691067 CGGAGCCGGGTCGTGGGGTCTGG 0: 1
1: 0
2: 0
3: 7
4: 166
1053142695_1053142706 -3 Left 1053142695 9:35691025-35691047 CCAGGCCGCCAAACCAGCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1053142706 9:35691045-35691067 CGGAGCCGGGTCGTGGGGTCTGG 0: 1
1: 0
2: 0
3: 7
4: 166
1053142694_1053142706 -2 Left 1053142694 9:35691024-35691046 CCCAGGCCGCCAAACCAGCGCCG 0: 1
1: 0
2: 0
3: 7
4: 61
Right 1053142706 9:35691045-35691067 CGGAGCCGGGTCGTGGGGTCTGG 0: 1
1: 0
2: 0
3: 7
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053142706 Original CRISPR CGGAGCCGGGTCGTGGGGTC TGG Intergenic
902304102 1:15524263-15524285 CGGGGGCGGGTCCTGGGGACTGG - Exonic
903859953 1:26358875-26358897 AGGAGCCGGGTCTTGCAGTCTGG + Intergenic
903931364 1:26864200-26864222 AGTAGCCTGGTCCTGGGGTCGGG - Exonic
904044317 1:27601004-27601026 TGGAACAGGGTCGTGGGGGCAGG - Intronic
904431848 1:30469403-30469425 TGGAGCGGAGTCGTGGAGTCTGG - Intergenic
904542091 1:31239931-31239953 CGGAGCCACGTGGTGGGGCCGGG - Intergenic
905245074 1:36607102-36607124 CAGAGCTGGGGTGTGGGGTCAGG - Intergenic
905891687 1:41522092-41522114 TGTAGCCGGGTGGTAGGGTCGGG + Intronic
906044405 1:42817061-42817083 CGGGGCGGGGTCGGGGGGCCGGG - Intronic
910130592 1:83900541-83900563 CGAAGCAAGGTCCTGGGGTCAGG + Intronic
919403259 1:197146471-197146493 CGGAGCCGCCTCGTGGGAGCGGG - Exonic
1070040892 10:72778526-72778548 TGGAGCCGGGGGGTGGGGTTTGG + Intronic
1072783698 10:98266864-98266886 TGGAGTCTGGTTGTGGGGTCAGG - Intronic
1073118130 10:101104313-101104335 CGCAGGCGGATCATGGGGTCTGG + Intronic
1076650300 10:131982444-131982466 CCGAGACGGCCCGTGGGGTCGGG + Intergenic
1077108068 11:850417-850439 CCGCGGCGGGTCGCGGGGTCTGG + Intronic
1077204705 11:1336776-1336798 CGGGGGCGGGGCGTGGGGGCGGG + Intergenic
1077204716 11:1336795-1336817 CGGGGGCGGGGCGTGGGGGCGGG + Intergenic
1077923150 11:6655977-6655999 CGGAGCCGGGGCCTGGGGCCGGG - Intergenic
1078422090 11:11220826-11220848 CGGGGTCGGGGAGTGGGGTCTGG + Intergenic
1083606980 11:63984836-63984858 CGTGGCCGGGTCATGAGGTCAGG + Intronic
1089499824 11:118925511-118925533 CGGGGCCGGGGCGCGGGGCCGGG + Intronic
1089665197 11:120013812-120013834 AGGAGCCGGGGGGTGGGGCCTGG - Intergenic
1096773964 12:53953075-53953097 CGGGGCCGGCTCCTGGGGGCGGG + Intergenic
1097157841 12:57025776-57025798 GGGAGCCGGGGCGGGGGGTGCGG + Intronic
1097223239 12:57462329-57462351 CCGGGCTGGGTCGCGGGGTCCGG + Intronic
1098060391 12:66554907-66554929 AGGAGCCAGGTCCTGGAGTCAGG - Intronic
1103828709 12:123762141-123762163 CGGGGCCGGGGCGTGGGCTGCGG + Intergenic
1104034303 12:125087772-125087794 CGGGGCAGGGTAGTGGGGCCTGG - Intronic
1104431503 12:128720127-128720149 CAGAGCTGGGCCGTGAGGTCGGG - Intergenic
1105898711 13:24739640-24739662 TAGAGCCGGGTCCTGGGATCAGG - Intergenic
1106075567 13:26458034-26458056 CGGAGCGGGGGCGGGGGCTCAGG - Intergenic
1112506723 13:99980432-99980454 CGGGCCCGGGCCGCGGGGTCAGG - Intergenic
1112913183 13:104514850-104514872 CGGAGCCCTGTCTCGGGGTCTGG - Intergenic
1113593749 13:111517876-111517898 GGGAGCCGGGGGGTGGGGCCAGG - Intergenic
1113694454 13:112333968-112333990 CTCGGCCGGGTCCTGGGGTCAGG - Intergenic
1113813100 13:113154071-113154093 GGGAGGCGGGGCGTGGGGGCGGG + Intergenic
1114459064 14:22875491-22875513 AGGGGACGGGTCTTGGGGTCAGG - Exonic
1116817918 14:49599935-49599957 CGGGGCCGGGGCGGGGGCTCCGG + Intronic
1118754823 14:68833416-68833438 GGGAGGCGGGTCATGAGGTCAGG - Intergenic
1119130473 14:72168121-72168143 TGGAGCCAGTTCATGGGGTCAGG + Intronic
1119520192 14:75279253-75279275 CGGTGCCGGCTCGGGGGCTCGGG + Intronic
1120190666 14:81436560-81436582 GGGAGCCGGGGCGGGGGGACTGG + Intergenic
1121039456 14:90733344-90733366 AGGAGCCGGGCTGTGGAGTCAGG - Intronic
1122803728 14:104246309-104246331 GGGAGCCAGGAAGTGGGGTCCGG + Intergenic
1122969370 14:105146289-105146311 AGGAGGCGGGTGCTGGGGTCCGG - Intronic
1125921680 15:43528908-43528930 CGGCGCCGGGTAGGGGGGCCAGG + Exonic
1129165102 15:73772482-73772504 CGGAGTTGGGTTGTGGAGTCTGG + Intergenic
1129675934 15:77632506-77632528 CGGAGCCGGGGCCGGGGCTCGGG + Intronic
1130317665 15:82810071-82810093 CGGCGGCGGGGCCTGGGGTCTGG + Exonic
1130333576 15:82940054-82940076 CCGAGGCCTGTCGTGGGGTCGGG + Intronic
1132372356 15:101307645-101307667 GGGAGCCGTGTGGTGGGGTGGGG - Intronic
1132978286 16:2721219-2721241 TGGGGCCGGGCCGTGGGGTCGGG + Intergenic
1135325010 16:21520557-21520579 CCGAGCTGGGTCGAGGGGGCGGG - Intergenic
1136336490 16:29613825-29613847 CCGAGCTGGGTCGAGGGGGCGGG - Intergenic
1136383857 16:29910853-29910875 AGGAGCCAGATCCTGGGGTCTGG - Intronic
1139775056 16:69311635-69311657 CGGAGCGGGGTCGCGAGGCCGGG - Intronic
1141579610 16:84988237-84988259 GGGCGTCGGGTGGTGGGGTCGGG + Intronic
1141727572 16:85799788-85799810 CCGGGCCGGGTCGGGGGGCCGGG + Exonic
1142966592 17:3585669-3585691 CAGAGCCTGGGCCTGGGGTCGGG + Intronic
1144884225 17:18447997-18448019 CGGAGTCGGTGCGTGGGGTTGGG + Intergenic
1145941291 17:28744490-28744512 CGGCGCCTTCTCGTGGGGTCAGG + Intronic
1146263326 17:31435677-31435699 TCCAGCTGGGTCGTGGGGTCAGG + Intronic
1146787410 17:35731917-35731939 CGGGGCCGGGTCAGGGGCTCGGG + Intronic
1146796436 17:35784599-35784621 AGGAGCAGGGGTGTGGGGTCAGG + Intronic
1148048719 17:44759087-44759109 CGGAGCCGGGGCGGGGGCGCGGG - Exonic
1148208618 17:45794846-45794868 CAGAGCCGGGTCCTGGGCCCTGG - Intronic
1148356512 17:46979089-46979111 AGGAGCCGGTCCGAGGGGTCCGG - Exonic
1150983448 17:70169319-70169341 CGGAGCCCGGCCGGGGAGTCGGG - Intronic
1152586399 17:81191370-81191392 CGGAGCCGGCCCGCGGGGCCAGG + Intronic
1152932281 17:83115974-83115996 CGGTGCCTGGTCCTGGGGGCTGG + Intergenic
1152980809 18:274388-274410 TGGAGCGGGGTTGTGGGGGCAGG - Intergenic
1155128155 18:22901326-22901348 CGGAGCGGGGGCGGGGGGTGGGG - Intronic
1160521807 18:79512158-79512180 CGAGGCCGTGTCCTGGGGTCAGG - Intronic
1161057743 19:2199172-2199194 CGGTGCCAGGTCTTGAGGTCTGG + Intronic
1161505000 19:4639278-4639300 CGGAGCCTGGGGGCGGGGTCAGG - Intergenic
1161738408 19:6005697-6005719 CGGTGCTGGGAAGTGGGGTCTGG + Intronic
1162079354 19:8209296-8209318 CGGGGCGGGGCCGTGGGGGCGGG - Intronic
1162741378 19:12775594-12775616 CGGAGCCTGGGCTTGGGGGCGGG - Intronic
1162906354 19:13826248-13826270 CGGAGCCTGGGGGTGGGGCCTGG + Intronic
1166165179 19:40982719-40982741 AGGAGACAGGTCCTGGGGTCAGG + Intergenic
1166809355 19:45506639-45506661 CGGAGCCGGCGTGTGGGGGCGGG + Intronic
1167248975 19:48390887-48390909 CGGATCCGGGGCCTGAGGTCAGG - Intronic
1167596821 19:50432390-50432412 CGGAGCCGGGAGGGAGGGTCCGG - Intergenic
1167648604 19:50718476-50718498 CGGAGCCGGCCCGGGGGGGCTGG - Intronic
925012633 2:497008-497030 CGGAGCCAGCACGAGGGGTCAGG - Intergenic
927679271 2:25129343-25129365 CGGGGGCGGGGCGTGGGGTGGGG + Intronic
929966911 2:46542991-46543013 CGGGGCCGGGGCGGGGGCTCCGG + Exonic
931487326 2:62706084-62706106 CGGGGCCGGGGCTCGGGGTCCGG + Intronic
932191578 2:69745223-69745245 CAGAGCTGGGTGGTGGGCTCTGG + Intronic
935918725 2:107986623-107986645 CGGAGCGGGGCCGGGCGGTCAGG - Exonic
936234659 2:110732658-110732680 CGGCGCCGGGTCTGGGGCTCGGG + Exonic
937232045 2:120403912-120403934 GGGAGCAGGGTTGTGGGGGCTGG + Intergenic
938455668 2:131460943-131460965 CGGGGCCGGGGCGGGGGCTCCGG + Intergenic
941991702 2:171563344-171563366 GGGAGCCAGGTCGTGGGTTGGGG - Intergenic
942449505 2:176100240-176100262 TGGAGCAGGGTCGTGGAGCCCGG - Exonic
947813020 2:233016068-233016090 GGGAGCTGGGTTGTGGGGACAGG - Intergenic
948206918 2:236167410-236167432 CGCAGCCGGGACGAGGGGGCGGG - Intronic
948824637 2:240568378-240568400 CGGGGCCGGGGCGCGGGGCCGGG - Intronic
1171391920 20:24807122-24807144 TGGAGCAGGGCCGTGGGGCCTGG - Intergenic
1172245564 20:33443270-33443292 GGGCGCGGGGTCGTGGTGTCTGG - Intronic
1172474570 20:35226999-35227021 CGGGGCCGGGGCGCGGGCTCGGG + Intronic
1174843519 20:53921521-53921543 TGGAGCTGGGGGGTGGGGTCGGG + Intergenic
1175035400 20:55995585-55995607 GGCAGGCGGATCGTGGGGTCAGG - Intergenic
1175249896 20:57602885-57602907 CCTAGCGGGGTGGTGGGGTCTGG + Intergenic
1175939401 20:62531152-62531174 CTGAGCCGGGCCCTGGGGCCGGG + Intergenic
1176068845 20:63215813-63215835 CGGGGCCGAGGCGCGGGGTCTGG - Intronic
1176233350 20:64042786-64042808 CGGGGCGGGGTCGTGGGGGACGG + Intronic
1176233423 20:64042932-64042954 CGGGGCGGGGTCGTGGGGGACGG + Intronic
1176233451 20:64042994-64043016 CGGGGCGGGGTCGTGGGGGACGG + Intronic
1179600539 21:42474716-42474738 CTGAGGTGGGACGTGGGGTCAGG - Intronic
1181511746 22:23392512-23392534 CAGAGCCTGGACCTGGGGTCAGG + Intergenic
1182017617 22:27053907-27053929 TGGAGCCAGGTCCTGGGGTGGGG + Intergenic
1182249927 22:28992166-28992188 CGGGGCCGGGGCGGGGGGTTGGG - Intronic
1182269796 22:29146108-29146130 CGGTGCCAGGTGGTGGGGTGTGG - Intronic
1185075540 22:48680180-48680202 CGGAGCCAGGGCCTGGGGTCTGG - Intronic
1185409688 22:50675019-50675041 CGGAGCGGGCTCGTGAGCTCAGG - Intergenic
950556109 3:13696959-13696981 CTGACCCTGGTCCTGGGGTCAGG + Intergenic
950759214 3:15206102-15206124 AGGAGCCGGGCCGCGGGGGCGGG - Intergenic
954081426 3:48214296-48214318 CAGGGCTGGGTCGTGGGGGCTGG + Intergenic
954333668 3:49903918-49903940 CGGAGTCGGGCCGTGGGGGCGGG + Intronic
955387540 3:58491778-58491800 CGGAGGCGGGACGTAGGGGCGGG + Intergenic
961775281 3:129279513-129279535 CGGAGCTGGGCAGTGGGCTCAGG + Intronic
962498486 3:135965953-135965975 CGGGGCCGGGACCTGGGGGCGGG + Intronic
968170143 3:196503563-196503585 CGGAGCCGCGTCCCGGGGCCCGG - Exonic
968674984 4:1872051-1872073 CGGCGCCGGGGCCAGGGGTCGGG + Intronic
971256188 4:25015703-25015725 GGGAGTAGGGGCGTGGGGTCGGG - Intronic
972480177 4:39489244-39489266 CTGAGTCGGGTCGGGTGGTCTGG - Intergenic
972671126 4:41214680-41214702 CGGGGCCGGGGGGTGGGGGCCGG + Intronic
980336512 4:131481109-131481131 CTGGGCCCTGTCGTGGGGTCGGG + Intergenic
984795871 4:183659425-183659447 CGGGCCCGGGGCGTGGGGCCTGG + Exonic
984888634 4:184473204-184473226 CGGAGCCGGGTCGGAGGGCACGG + Intronic
985679075 5:1246541-1246563 GGGAGCGGGGGCCTGGGGTCTGG + Intergenic
989200328 5:38756807-38756829 GGGAGCCGGGGGGTGGGGTCTGG - Intergenic
989316235 5:40082269-40082291 GGGAGCCGGGTTGTGGAGTGAGG - Intergenic
993386346 5:87267761-87267783 CGGAGCGGGGGCGGGGGGCCGGG - Intergenic
998142861 5:139709783-139709805 CAGAGCCGGGGCGTGGAGGCGGG - Intergenic
1000408842 5:160917225-160917247 TGGAGCTGGGTTGTGGGGCCAGG + Intergenic
1002355533 5:178626439-178626461 AGGAGCCGGGAGGTGGGGACCGG - Intronic
1002418781 5:179134886-179134908 TGGAGCCGGGAGCTGGGGTCTGG - Intronic
1003556308 6:7142575-7142597 CTGAGACAGTTCGTGGGGTCAGG + Intronic
1004834532 6:19516126-19516148 CAGAGCCGGGGTGGGGGGTCTGG - Intergenic
1006414070 6:33893062-33893084 CGGGGCCGGGGCGAGGGGGCGGG + Intergenic
1006642867 6:35497526-35497548 CGGAGCCGGGTCTGGGGCCCCGG - Intergenic
1007626154 6:43247388-43247410 CGGAGCGGGGGCGTGAGGGCTGG + Intronic
1012212022 6:96531147-96531169 CGGACCCGGGTTGTGGGGGATGG - Intronic
1012887183 6:104859544-104859566 GTGAGCCGGGTCGCGGGGCCAGG - Intronic
1014802361 6:125791034-125791056 GGGCGCCGGCTCCTGGGGTCCGG - Exonic
1018709919 6:166491022-166491044 CAGAGCAGGGTCCTGTGGTCAGG + Intronic
1018871653 6:167788381-167788403 CGGGGCCGGGGGGTGGGGTGGGG + Intronic
1019660069 7:2219304-2219326 CGGGGCCAGGGTGTGGGGTCGGG - Intronic
1025796545 7:64742995-64743017 AGCAGGCGGGTCGTGAGGTCAGG + Intergenic
1032125464 7:129189493-129189515 CGGAGCCGGGTCTGGGGGGCGGG + Intronic
1035020411 7:155797249-155797271 GGGAGCCGGGTCGGGGGCTGGGG - Intergenic
1035187831 7:157139532-157139554 CGGAGCCGAGACTTGGGGCCAGG + Intronic
1035293494 7:157854694-157854716 CGAGGCAGGGTCCTGGGGTCGGG - Intronic
1035818095 8:2562235-2562257 CGGGGCTGGGTCGTGGGTCCCGG - Intergenic
1037957683 8:23071590-23071612 CAGAGCCAGGACCTGGGGTCCGG - Intergenic
1037962027 8:23105001-23105023 CAGAGCCAGGACCTGGGGTCAGG - Intronic
1037969427 8:23161408-23161430 CAGAGCCAGGACCTGGGGTCAGG + Intronic
1038883591 8:31640029-31640051 CGGAGCCGGGGCGCTGGGCCCGG - Intronic
1039455163 8:37701071-37701093 TGGAGCGGGGTCCTGGCGTCGGG - Intergenic
1049325621 8:142020023-142020045 CGGGGCCGGGGCATGGGGTTTGG + Intergenic
1049398089 8:142411246-142411268 CAGAGCTGGGCCGAGGGGTCAGG - Intergenic
1049743122 8:144250432-144250454 CAGAGCCGGGTGGAGGGCTCGGG - Intronic
1053066243 9:35071759-35071781 TGGAGCCGGGTCGGCGGGGCCGG - Intronic
1053142706 9:35691045-35691067 CGGAGCCGGGTCGTGGGGTCTGG + Intergenic
1056261183 9:84850467-84850489 TGGAGCCAGGTCATGGGGCCAGG + Intronic
1060484983 9:124041101-124041123 CGGAGCTGGGACGCCGGGTCTGG + Intergenic
1060984106 9:127809902-127809924 CGGGGCGGGGTCGTGGGGAAGGG + Intronic
1061293718 9:129666175-129666197 CGGGGCCGGGGCGCGGGGTCCGG + Intronic
1189324049 X:40102496-40102518 CCGAGGCGGGACGTGGCGTCCGG - Intronic
1199060195 X:143346770-143346792 CGGAGCCTGTTGGTGGGGTGGGG - Intergenic
1200829105 Y:7673357-7673379 CGGGGCCGGGGTGTGGGCTCAGG - Intergenic