ID: 1053143884

View in Genome Browser
Species Human (GRCh38)
Location 9:35699025-35699047
Sequence GACTGACCTTGGGTTTGGCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053143877_1053143884 8 Left 1053143877 9:35698994-35699016 CCATGGTGAGGGTGGAAGAGGAA 0: 1
1: 0
2: 5
3: 42
4: 375
Right 1053143884 9:35699025-35699047 GACTGACCTTGGGTTTGGCCCGG 0: 1
1: 0
2: 1
3: 12
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053143884 Original CRISPR GACTGACCTTGGGTTTGGCC CGG Exonic
902373463 1:16019127-16019149 GACTGACCTTGCCCTGGGCCAGG + Intronic
904702121 1:32363896-32363918 GACTGACTTTGGCTTTGCCAAGG + Exonic
906699969 1:47850631-47850653 GCCTGACTTGGGATTTGGCCTGG + Intronic
907927585 1:58968877-58968899 GGCTGACACTGGCTTTGGCCTGG - Intergenic
909560774 1:77007093-77007115 TACTGACACTGGGCTTGGCCAGG - Intronic
909664064 1:78114298-78114320 GACTGATTTAGGGCTTGGCCTGG + Intronic
917095792 1:171397663-171397685 ACCTGACCCTTGGTTTGGCCCGG - Intergenic
919075848 1:192811672-192811694 GACTGACCTTGAATTCAGCCTGG + Exonic
919284993 1:195545910-195545932 GAATGACCTAGGGTTTGCTCAGG + Intergenic
922703513 1:227776171-227776193 GTCTGGCCATGGGTCTGGCCAGG + Intronic
1063869524 10:10402756-10402778 GAGGGAGCTTGGGTATGGCCAGG + Intergenic
1067279032 10:44857515-44857537 GAAAGCCCTTGGGTCTGGCCAGG + Intergenic
1068028028 10:51673063-51673085 GACTGACCTTGGGATGGCTCTGG - Intronic
1069659271 10:70112863-70112885 AAGTGACCCTGGGGTTGGCCAGG + Exonic
1070795595 10:79214626-79214648 GACTGCCATGGGGTTTGGCCTGG - Intronic
1071885820 10:89949823-89949845 GACTGACTTTGTGTTTGTCAAGG + Intergenic
1074061277 10:109968081-109968103 GGCTGACCCCGGGTTAGGCCAGG - Intergenic
1074325559 10:112447330-112447352 CCCTGACCTAGGCTTTGGCCTGG + Exonic
1077354262 11:2107818-2107840 TCCTGGCCTTGGGTCTGGCCTGG - Intergenic
1077942270 11:6855686-6855708 GCCCGACCTTCAGTTTGGCCTGG + Intergenic
1078552635 11:12290899-12290921 GATGGGACTTGGGTTTGGCCTGG + Intronic
1078759023 11:14236841-14236863 CACTGACTTTGGCTTTGGCACGG + Intronic
1079187000 11:18246868-18246890 AACTGGCCTGGGGTGTGGCCTGG - Intronic
1079189803 11:18268031-18268053 AACTGGCCTGGGGTGTGGCCTGG + Intronic
1080447901 11:32354000-32354022 GACTGGCCCTGGGGTTGACCCGG + Intergenic
1082983247 11:59143327-59143349 GGCTGACCTGGAGTTTTGCCAGG + Intronic
1086305943 11:85482064-85482086 GCCTGGCCTTGGGGTTGGTCTGG - Intronic
1086337011 11:85810635-85810657 GACTGACCTGGGCTTGGGGCTGG - Intronic
1086363272 11:86081384-86081406 AAATGACCTTGGGTATGGCAGGG - Intergenic
1095701988 12:45200165-45200187 AACTAAGCTTGAGTTTGGCCAGG - Intergenic
1096098655 12:48955867-48955889 GATTGACCTTGGATTCAGCCAGG - Intronic
1099679243 12:85803959-85803981 GAATGAACATGGGTTTGGTCAGG + Exonic
1101169112 12:102069901-102069923 GATTAACCTTAGTTTTGGCCAGG + Intergenic
1104867300 12:131964979-131965001 TCATGACCTTGGCTTTGGCCTGG + Intronic
1104972436 12:132538074-132538096 GAGTGAGCTTGGGTGTGGCTGGG + Intronic
1106133852 13:26960034-26960056 TGCTGGCCTTGGCTTTGGCCTGG - Intergenic
1107644248 13:42477654-42477676 GACTGATCCTGGAATTGGCCTGG + Intergenic
1110475690 13:75910802-75910824 GCCTGACCCTGGGTTTGGTCTGG + Intergenic
1110750218 13:79105726-79105748 CGATGACCTTGGGTTTGGCAAGG - Intergenic
1110762686 13:79248074-79248096 TAGTGACCTTGGGCTTGGCAAGG + Intergenic
1112918762 13:104583764-104583786 GAATGACTATGGTTTTGGCCAGG + Intergenic
1116345390 14:43786535-43786557 GAATGACCTGGAGTTTGGCCAGG - Intergenic
1116394710 14:44433512-44433534 GCCTGACCCTCGGTTTGGTCCGG + Intergenic
1117928243 14:60808122-60808144 GTCTGTCCTTGTGTTTGGCTTGG + Intronic
1121106485 14:91283322-91283344 GACTCACCTTTGGTGCGGCCTGG + Exonic
1123480405 15:20625850-20625872 GACTGACCATGGACTTGTCCTGG - Intergenic
1123637603 15:22374515-22374537 GACTGACCATGGACTTGTCCTGG + Intergenic
1123982062 15:25613408-25613430 CACTGACCTTGGGCTTGCCCTGG - Intergenic
1124546575 15:30633072-30633094 CACTGACCATGGATTTGGCAAGG + Intronic
1124780176 15:32623074-32623096 CACTGACCATGGATTTGGCAAGG + Intronic
1126740704 15:51773406-51773428 TACTGCCCTTGGGTCTGGGCAGG - Intronic
1129602049 15:77004954-77004976 AATTGACCTGGGGTGTGGCCTGG - Intronic
1130847505 15:87761133-87761155 GAGTGAACTTGGCTTTGGGCAGG + Intergenic
1131321698 15:91399892-91399914 GCCTGGCATTGGGGTTGGCCTGG + Intergenic
1132552171 16:558050-558072 GGCTGACTTTGGGTTTGGAGAGG - Intergenic
1133245585 16:4446798-4446820 GTCTGAGCTTGGGCCTGGCCAGG + Intronic
1134134475 16:11669785-11669807 GACTGACCTTGGGGCAGTCCCGG + Intronic
1135917096 16:26614962-26614984 GATAGACCTTGGTTTTGGCTTGG + Intergenic
1138536605 16:57663654-57663676 GACTGGCCTGGGGCTGGGCCGGG - Exonic
1144734281 17:17546298-17546320 CACTGCCCCTGGGTTTGGCCGGG + Intronic
1144784808 17:17825551-17825573 GAGTGAGCCAGGGTTTGGCCAGG - Intronic
1147325247 17:39666876-39666898 GACTGTCCTTGGCTTTGCCTCGG + Intergenic
1148055991 17:44796021-44796043 GAATGACATGGAGTTTGGCCTGG - Intergenic
1148326845 17:46788302-46788324 GACTGACTTAGGGTTTGGAGGGG - Intronic
1148344463 17:46894365-46894387 ACCCGACCTTGGGTTTTGCCAGG + Intergenic
1149691987 17:58585201-58585223 TACTGACCCTGGTTTTGGCGAGG - Intronic
1152383711 17:79956210-79956232 CACAGACCTTTGGTTTGGGCTGG - Intronic
1152587690 17:81196324-81196346 TCCTGACCTGGGGTCTGGCCTGG - Intronic
1154274419 18:12947442-12947464 GACGAACCGTGGGTTTGGTCAGG - Intronic
1156484115 18:37453982-37454004 GGCTGACCTTGGGTTTTGCCTGG + Intronic
1157236165 18:45967191-45967213 GGCTGGCCTTGGCCTTGGCCCGG + Exonic
1160812886 19:1020587-1020609 CTCTGACCCTGGGATTGGCCAGG - Intronic
1162111524 19:8402381-8402403 GAGTGGCCTTGGGATGGGCCAGG + Intronic
1162780489 19:13004402-13004424 GACTGTGCCTGGGTTTGGCAGGG - Intronic
1163553538 19:17979656-17979678 GACTGGCCCTGGATATGGCCAGG + Intronic
1164986812 19:32654257-32654279 GACTGCCCTTGAGTCTGCCCTGG - Intronic
1165427918 19:35755918-35755940 GACTGTCATTGGGCTGGGCCAGG + Intronic
1165461860 19:35948613-35948635 GAGTGACCTTGGGTTGAGGCTGG + Intergenic
1166328430 19:42065323-42065345 GTCTGGCCTTGGCCTTGGCCCGG - Exonic
1166903047 19:46081125-46081147 CCCTGACCTTTGGTGTGGCCTGG - Intergenic
1167914364 19:52728132-52728154 TCCTGACCTCGGGATTGGCCAGG + Intronic
925779831 2:7372044-7372066 GACTGTCTTTGGCCTTGGCCTGG - Intergenic
926976186 2:18519236-18519258 GACAGAACTTGGGCTTTGCCTGG - Intergenic
929816769 2:45238706-45238728 GAATGACCTTGACTTTGACCAGG + Intergenic
934522221 2:95026552-95026574 GACTGACCTTGGGCAGGCCCGGG + Intronic
935949520 2:108316211-108316233 GCCTGACCCTCGGTTTGGTCTGG + Intergenic
937148896 2:119672365-119672387 GACTGACCTGGTGTTTCCCCAGG - Intergenic
943376789 2:187087314-187087336 GAATGGCCTTGTGTTGGGCCAGG - Intergenic
947138658 2:227000685-227000707 GACTGACCTTGGGTTTCTAGGGG + Intergenic
948864453 2:240768264-240768286 GACAGGCCTTTGGTTTGGTCTGG - Intronic
1171063408 20:21988344-21988366 GCCTGGCCTTGGGGCTGGCCTGG - Intergenic
1172313645 20:33936733-33936755 GATTGACCTGGGGTGGGGCCTGG + Intergenic
1172903957 20:38355300-38355322 CACTGAACTTGGGGATGGCCGGG - Intronic
1174422215 20:50406698-50406720 TAGTGCCCTTGGGTTTGGTCTGG + Intergenic
1175996465 20:62814278-62814300 GGCTTCCCTTGGGGTTGGCCGGG + Intergenic
1178859325 21:36275871-36275893 GACTGACCCTGGGTGTGGGTGGG + Intronic
1180840106 22:18955168-18955190 TGCTGACCTTGGGCTAGGCCAGG + Intergenic
1180937045 22:19632741-19632763 GAATGACGTGGAGTTTGGCCGGG - Intergenic
1181050447 22:20235843-20235865 GAATGACCTGGAGTTTGGCTGGG + Intergenic
1181061798 22:20285321-20285343 TGCTGACCTTGGGCTAGGCCAGG - Intergenic
1183180237 22:36255061-36255083 GACTGGGCTTGGGCTGGGCCAGG + Intronic
1184874688 22:47266749-47266771 CACTGACACTGGGCTTGGCCAGG - Intergenic
950643500 3:14363456-14363478 TGCTGACCTTGGATTTGGCTGGG - Intergenic
951734425 3:25848728-25848750 GCCTGACCCTTGGTTTGGTCCGG - Intergenic
954814494 3:53270092-53270114 GTCTGGCCCTGGGATTGGCCAGG - Intergenic
958020538 3:87989754-87989776 GCCTGACCCTCGGTTTGGTCTGG - Intergenic
962527459 3:136249676-136249698 GACTGACAATGTGGTTGGCCAGG - Intergenic
963062414 3:141235345-141235367 GATTGGTCTGGGGTTTGGCCTGG + Intronic
964517237 3:157525345-157525367 GACTGACCCTGGGTTGAGACAGG + Intronic
965493528 3:169369275-169369297 GACTGTCTCTGGTTTTGGCCTGG - Intronic
966331990 3:178824667-178824689 GACTGACATGAGATTTGGCCGGG - Intronic
968062931 3:195739768-195739790 GAGGGACCTTGGGTTTGGGGCGG + Intronic
968284868 3:197502576-197502598 GACAGACCTGGGGCTAGGCCTGG - Intergenic
969391390 4:6893555-6893577 GACTGGGCATGGGTTTGGCCTGG + Intergenic
976976352 4:91169323-91169345 GACTAAACTTGTATTTGGCCAGG + Intronic
980853103 4:138407468-138407490 GGCTGTCATTGAGTTTGGCCTGG - Intergenic
982284468 4:153720636-153720658 GAGTTACCTGGGGTGTGGCCTGG - Intronic
986533531 5:8762844-8762866 GATAGACCTTGGTTTGGGCCTGG + Intergenic
989183774 5:38603509-38603531 CCCTGACCTTGGGTTTGGAAGGG - Intronic
991115233 5:62946937-62946959 GAATGACGTGGAGTTTGGCCAGG + Intergenic
992752520 5:79874440-79874462 CCCTGACCTTGGGGTTGCCCAGG - Intergenic
994127430 5:96184093-96184115 TACTGACATTGTCTTTGGCCAGG + Intergenic
999282740 5:150375744-150375766 GACTGGAGGTGGGTTTGGCCTGG - Exonic
1003112602 6:3262040-3262062 GGCTGACCTTGGGTTGAGCAGGG + Intronic
1003157222 6:3607030-3607052 ACCTCACCTTGGGTTTGTCCTGG + Intergenic
1006037837 6:31227995-31228017 AACTGTCCTTGGGTTGGGCACGG + Intergenic
1008588463 6:52970199-52970221 AACTCACCTTGGGTTGGGGCAGG - Intergenic
1016230077 6:141792623-141792645 GACTAACTTTGGGTTTGGTTTGG - Intergenic
1017267512 6:152465857-152465879 GAGTGACCTTGCCATTGGCCAGG - Intronic
1019065423 6:169292145-169292167 CACTGACCTTGTGTGAGGCCGGG + Intergenic
1019677732 7:2325041-2325063 GACTGTCCTTGAGACTGGCCTGG - Intronic
1020903676 7:14038249-14038271 GACTAACCTTGTTTTGGGCCTGG - Intergenic
1021739671 7:23673545-23673567 GACTAAACTTGTATTTGGCCAGG - Intergenic
1024666247 7:51550077-51550099 GCCATACCTTGGGTTTAGCCTGG + Intergenic
1025106507 7:56175312-56175334 GACTGACCGTGGCCTTGGGCAGG + Intergenic
1026038535 7:66846782-66846804 GCCTTACCTTGGGTTTCTCCTGG + Intergenic
1029287055 7:99472968-99472990 GACAGACCTCGGGTCAGGCCCGG + Exonic
1029409623 7:100400511-100400533 GACAGGCTTTGGGTTTGGGCTGG - Intergenic
1031239392 7:119219087-119219109 GCCTGACATTGGGGTGGGCCTGG + Intergenic
1032415124 7:131729792-131729814 AAAAGAGCTTGGGTTTGGCCTGG + Intergenic
1032590233 7:133185331-133185353 GACTCACCTTGGGTTGGGTCAGG - Intergenic
1035180987 7:157089470-157089492 CATTGTCCTTGGGTTTGGTCGGG + Intergenic
1037435915 8:18863171-18863193 CATTGAACTTGGGTTTGGACAGG - Intronic
1037710339 8:21350566-21350588 GTCTGGCCTTGGCCTTGGCCGGG - Intergenic
1038286509 8:26210524-26210546 GCCTGACCCTCGGTTTGGTCTGG + Intergenic
1040583174 8:48714096-48714118 GACTGACCTTGGTCTTTGCCTGG - Intronic
1041461844 8:58119972-58119994 GACCGACCTTGGCTTGGCCCTGG - Intronic
1041784049 8:61611621-61611643 GGCAGAACTTGGGGTTGGCCAGG + Intronic
1044603347 8:94027245-94027267 GAATGACATTGGGTTGGGCGTGG - Intergenic
1049472318 8:142782013-142782035 GACTGTCCTTGGGCTTGGTCTGG + Intergenic
1050146441 9:2573153-2573175 ATCTGACCTTGGCTTTGCCCTGG + Intergenic
1053143884 9:35699025-35699047 GACTGACCTTGGGTTTGGCCCGG + Exonic
1056280287 9:85035137-85035159 GACTGACCTTGTGTTCTACCTGG - Intergenic
1058059071 9:100475790-100475812 GAGTGACCTCGGGTATGGGCAGG + Intronic
1059947092 9:119420489-119420511 GGCTGACCTTGGACTTGGGCTGG - Intergenic
1060222392 9:121771667-121771689 GACTGACCTGGTGTGTGGCCTGG + Intronic
1187276835 X:17823741-17823763 CACTGGCCTTGGGTGTGGCCTGG - Intronic
1187592507 X:20733735-20733757 CATTGATTTTGGGTTTGGCCAGG + Intergenic
1189283796 X:39837865-39837887 CACTGACTGTGGGTTTGGCCAGG - Intergenic
1190962379 X:55265207-55265229 GGCTGTCCTTGGGCTGGGCCTGG - Intronic
1192748507 X:73963859-73963881 GAATGACGTGGAGTTTGGCCTGG - Intergenic
1196082510 X:111648882-111648904 CACTGATCTTGGGGCTGGCCTGG + Intergenic
1199802717 X:151267462-151267484 GACTGTCCTTAGCTTTGGCTTGG - Intergenic