ID: 1053144631

View in Genome Browser
Species Human (GRCh38)
Location 9:35704174-35704196
Sequence ACTAAGCTGGGCCCTCCCTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 149}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053144631_1053144637 11 Left 1053144631 9:35704174-35704196 CCTGAGGGAGGGCCCAGCTTAGT 0: 1
1: 0
2: 0
3: 8
4: 149
Right 1053144637 9:35704208-35704230 TACCCGCTCCAGCCCGTCCAAGG 0: 1
1: 0
2: 1
3: 8
4: 80
1053144631_1053144644 24 Left 1053144631 9:35704174-35704196 CCTGAGGGAGGGCCCAGCTTAGT 0: 1
1: 0
2: 0
3: 8
4: 149
Right 1053144644 9:35704221-35704243 CCGTCCAAGGTGCCTGGTCCAGG 0: 1
1: 0
2: 0
3: 8
4: 119
1053144631_1053144640 18 Left 1053144631 9:35704174-35704196 CCTGAGGGAGGGCCCAGCTTAGT 0: 1
1: 0
2: 0
3: 8
4: 149
Right 1053144640 9:35704215-35704237 TCCAGCCCGTCCAAGGTGCCTGG 0: 1
1: 0
2: 1
3: 10
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053144631 Original CRISPR ACTAAGCTGGGCCCTCCCTC AGG (reversed) Exonic
900718264 1:4158870-4158892 AAGAAGAGGGGCCCTCCCTCTGG - Intergenic
901493352 1:9607740-9607762 CCTCAGCCGGGCCCTCTCTCTGG + Exonic
901918626 1:12519782-12519804 GCTAAGCAGGTCCCTGCCTCAGG - Intergenic
902251278 1:15155280-15155302 ACTAGGCTGGGGGCTCCCTGAGG - Intronic
904142561 1:28365359-28365381 ACTAACCTAGCCCCTTCCTCGGG + Intergenic
907133479 1:52117898-52117920 ACCAACCTGTGCCCACCCTCCGG - Intergenic
910978236 1:92930875-92930897 ACTAAGATGGTCCCTTCCTGGGG + Intronic
915247940 1:154569297-154569319 ATTAATCTGGGGCCTCCCTGGGG + Intronic
919422054 1:197382024-197382046 ACTGAGCTGGGCAGTCCCTTAGG + Intronic
924551298 1:245080499-245080521 CCTCAGCTGGTCCCTCACTCAGG + Intronic
1064106866 10:12507721-12507743 TCTCAGCTGGGCCCTTCCTGTGG + Intronic
1066440504 10:35434357-35434379 GCTCAGCTGGGCACTCCATCAGG - Intronic
1067066149 10:43105376-43105398 ACCCAGCTGGGCCTTGCCTCGGG + Intronic
1067457159 10:46427233-46427255 ACTGGGCTGGGCCCTCCTGCTGG - Intergenic
1067751851 10:48976910-48976932 CCCATGCTGGGCCCTCCATCAGG - Exonic
1068932772 10:62608609-62608631 ACTGACCTGGGCCCACTCTCTGG + Intronic
1069462255 10:68606570-68606592 ACTAAGCTTGACCATCCTTCAGG + Intronic
1070547668 10:77465354-77465376 ACTTTGCTGGTCCCTCCTTCTGG + Intronic
1071325635 10:84514058-84514080 TCTAAGCTCCGCCCCCCCTCAGG + Exonic
1071482183 10:86073263-86073285 AATAAATTGGTCCCTCCCTCAGG - Intronic
1071829105 10:89354350-89354372 ACCAAGCTGTGCCCTACCTTGGG + Intronic
1075933942 10:126323647-126323669 ACCAGCCTGTGCCCTCCCTCAGG - Intronic
1078934517 11:15939625-15939647 ACCAAGCTGGGCCATGGCTCAGG - Intergenic
1081474366 11:43411258-43411280 ACTAAGCATGCCCCTACCTCAGG + Intronic
1083635670 11:64119645-64119667 ACTCAGCTGGGCCCACCCCTGGG + Intronic
1083960652 11:66013113-66013135 AGGAAGCTGGGGCTTCCCTCGGG + Intronic
1085473547 11:76773491-76773513 TCTCAGCCAGGCCCTCCCTCAGG + Intergenic
1087124927 11:94615338-94615360 ACTGAGCTGTGCCCTCCGTAGGG + Intronic
1088700004 11:112403297-112403319 CCTTAGCTGGGCCCTGCCCCTGG - Intergenic
1090255704 11:125282479-125282501 AGATTGCTGGGCCCTCCCTCTGG + Intronic
1090786923 11:130057641-130057663 AGTAAGCTGGGCTCACTCTCTGG + Intergenic
1096123808 12:49105543-49105565 ACCAAGCATGCCCCTCCCTCAGG + Intronic
1102209477 12:111114679-111114701 CCTAAGCTGTGCCCTCTGTCTGG + Intronic
1102349217 12:112179698-112179720 ACTGAGGTGTGCCCACCCTCGGG - Intronic
1104726982 12:131084293-131084315 AGGAAGCAAGGCCCTCCCTCTGG - Intronic
1110766914 13:79290786-79290808 AGTAATCTGGGCCCTCTCTTGGG - Intergenic
1114258468 14:21021571-21021593 TCTATGCTTGGCCCTGCCTCAGG - Intronic
1120640496 14:87005505-87005527 ACTTATCTAGGCCCTACCTCAGG + Intergenic
1122411456 14:101528141-101528163 ACCCACCTGGGCCCTCCCTGTGG - Intergenic
1128393662 15:67201370-67201392 ACTGAGCTGTCCCCTCCCTGTGG + Exonic
1129227960 15:74180765-74180787 ACGAAGGTGCGCCCTCCCACTGG - Exonic
1129252993 15:74318944-74318966 GCTAGTCTGGGCCCTACCTCTGG + Intronic
1129261124 15:74367892-74367914 CCTGAGCTGGGGCCTCCCACTGG + Intergenic
1129328519 15:74814912-74814934 ACCAAGCTGGGCCCTGCTTCAGG + Intronic
1129389272 15:75212550-75212572 AGTGTGCTGGGCCCACCCTCTGG + Intergenic
1129654970 15:77518056-77518078 ACTAGCCTGGCCCCTGCCTCTGG + Intergenic
1134020097 16:10915565-10915587 CCTAGGCTGGGCCCTGTCTCAGG + Exonic
1134128129 16:11630277-11630299 ACAAAGCTGGGTCCTCTCTGAGG + Intronic
1134799299 16:17069871-17069893 ACTAAGCTAAGCCCTTCCTGAGG - Intergenic
1136173782 16:28503965-28503987 GCTCAGCTGGGGCCTCCCTGGGG + Exonic
1136929975 16:34410004-34410026 ACTGAGCTGGGCCTTCACACTGG - Intergenic
1136974599 16:35001801-35001823 ACTGAGCTGGGCCTTCACACTGG + Intergenic
1138458989 16:57136979-57137001 ACCATGCTGGCCCTTCCCTCTGG + Intronic
1138459308 16:57138599-57138621 ACTCTGCAAGGCCCTCCCTCAGG + Intronic
1138492009 16:57382446-57382468 ACCAACCTGGGCCCAGCCTCTGG + Exonic
1142357794 16:89611539-89611561 ACAAAGCTAGCCCCTTCCTCAGG - Intergenic
1143464986 17:7130773-7130795 AGGAAGCTGGGGCCTTCCTCTGG - Intergenic
1143926845 17:10378681-10378703 AGTAAGCTGGGGACTCTCTCAGG - Intergenic
1147363487 17:39945554-39945576 CCTCAGCTGGGGGCTCCCTCAGG - Intergenic
1147363918 17:39947964-39947986 CCTCAGCTGGGTGCTCCCTCAGG - Intergenic
1148022464 17:44562509-44562531 AGTGGGCTGGTCCCTCCCTCTGG + Intergenic
1148108134 17:45130332-45130354 ACTAAACTGTGCACTCCCTGAGG + Intronic
1148371050 17:47100141-47100163 TCTCAGCCGGGCGCTCCCTCGGG + Intergenic
1150267654 17:63841806-63841828 ACTGGGCTGGGCCTCCCCTCAGG + Intronic
1150609656 17:66723740-66723762 ACTATGCTGGGCTCTCTCTCTGG - Intronic
1151340788 17:73469470-73469492 ACAGACCTGGGCCCGCCCTCTGG - Intronic
1152411298 17:80124638-80124660 TCTCACCTGGGCCTTCCCTCTGG - Intergenic
1152506714 17:80754217-80754239 ACTCAACTGGGCTCTCCCGCAGG + Intronic
1154356397 18:13625598-13625620 GCTGAGCTGGGCACTCCCTCAGG - Intronic
1162208200 19:9071712-9071734 AATAGGCTGTGCCTTCCCTCGGG - Intergenic
1165282938 19:34813782-34813804 AGTGAGCTGGGCCCTCACTCTGG + Intergenic
1165490450 19:36120330-36120352 CCTAAGCTGGCCCCAACCTCAGG - Intronic
1166690090 19:44817312-44817334 ACCAAGTTGGGGCCTGCCTCAGG - Intronic
1166910716 19:46154367-46154389 ACTAAGAAGGGCCCTCCTCCTGG - Intronic
1167696563 19:51018874-51018896 AGTCAGCTGGGCCCTTCTTCTGG - Intronic
929489352 2:42382632-42382654 ACTAAGGTGGGCCAGACCTCAGG + Intronic
929841308 2:45466846-45466868 AGTCTCCTGGGCCCTCCCTCAGG - Intronic
930001057 2:46861650-46861672 ACAAAGCTGGGCTCTCTCCCAGG - Intergenic
932761174 2:74440167-74440189 ACTAAGCTGGAACCCCTCTCGGG - Intronic
935290668 2:101608251-101608273 GATCAGCTGGGCCCACCCTCAGG + Intergenic
936075851 2:109401444-109401466 AGGAAGAAGGGCCCTCCCTCTGG - Intronic
938992234 2:136641339-136641361 GCTCAGCTGGGCATTCCCTCAGG + Intergenic
944375565 2:199037685-199037707 ACTTCTCTGGGCCCTCCTTCTGG + Intergenic
948592626 2:239060923-239060945 ACACAGCGGGGCCGTCCCTCTGG - Intronic
1168959371 20:1858104-1858126 ACAAAGCTGGGACCACCCCCAGG + Intergenic
1170746357 20:19102677-19102699 ACTCAGCTGGGCTCACTCTCAGG + Intergenic
1172708642 20:36902519-36902541 ACTAAGCTGGGCCTTCTGGCAGG - Intronic
1172872312 20:38143441-38143463 GGTATGCAGGGCCCTCCCTCCGG - Intronic
1173380529 20:42535660-42535682 ACTAATCTGGTGCCTCCCTGAGG - Intronic
1174387827 20:50197758-50197780 ACGGAGCTGGGCCCTGCCTCGGG - Intergenic
1175284891 20:57831408-57831430 ACTAAGCTGTGTACTCCCTAGGG + Intergenic
1175686162 20:61030207-61030229 ACACAGCTGGATCCTCCCTCTGG - Intergenic
1178091811 21:29171597-29171619 ACTAAGCTGGTCCTGACCTCAGG - Intronic
1179220465 21:39402448-39402470 ACAATGCTGGGACCTCCCTGGGG - Intronic
1179509772 21:41864921-41864943 GCCAAGCTGGGTCCTGCCTCTGG + Intronic
1181029870 22:20144525-20144547 GCTGGGCTGGGCTCTCCCTCTGG - Intronic
1181600884 22:23951318-23951340 GCTGAGCAGGGTCCTCCCTCTGG - Intergenic
1181607629 22:23990008-23990030 GCTGAGCAGGGTCCTCCCTCTGG + Intergenic
1182409449 22:30170767-30170789 CCTGAGTTGGTCCCTCCCTCTGG + Intronic
1184423426 22:44395201-44395223 ACTATGCTGGGCACGCCCTGTGG + Intergenic
1184510959 22:44932836-44932858 AGTAAAATGGGCCCTTCCTCTGG - Intronic
1184958997 22:47915179-47915201 CCTACGCTGGGCCCTCACCCTGG - Intergenic
1185032325 22:48450595-48450617 CCAAAGCAAGGCCCTCCCTCGGG + Intergenic
1185032728 22:48453193-48453215 CCAAAGCAAGGCCCTCCCTCAGG + Intergenic
1185392797 22:50571703-50571725 ACAAAGCTGAGCCCGGCCTCTGG - Intronic
1185393374 22:50574419-50574441 GCCATGCTGGGCCTTCCCTCAGG - Exonic
949489370 3:4573658-4573680 ACTAAGATTGTCCCTGCCTCAGG + Intronic
950778789 3:15373407-15373429 ACGAAGCTGAGCACCCCCTCTGG + Intergenic
952847376 3:37699792-37699814 ACTAAGCTTATCCCTGCCTCAGG + Intronic
954983122 3:54764186-54764208 ACTAAACTTGGCCCTCCCTTGGG + Intronic
959545827 3:107595117-107595139 ACTAGGCTGGACCATCCATCTGG + Intronic
964421891 3:156511917-156511939 ACTAAGCTCTGTCCTTCCTCAGG + Intronic
967138842 3:186535897-186535919 ACTAAGCTCAGCTCTCCCTGTGG - Intergenic
968813571 4:2810701-2810723 TCAAAGCTGGGCCCCTCCTCTGG + Intronic
973749038 4:53994243-53994265 TCTAAGCTTGGCCCAACCTCGGG - Intronic
975833885 4:78400104-78400126 CTTAAGCTGGGCCCTCTGTCTGG + Intronic
978010903 4:103682717-103682739 ACTTAGCTGGGTCCTCTCTTAGG + Intronic
985661891 5:1161493-1161515 TGTGGGCTGGGCCCTCCCTCTGG + Intergenic
985908184 5:2858022-2858044 ACAAAGCTGGCCTCTCCATCAGG - Intergenic
990980892 5:61601663-61601685 CATCAGCTGGGCCCTCCCTGTGG - Intergenic
992567417 5:78012653-78012675 AGTAACTTGGGCCCTCCCCCAGG + Intronic
997773763 5:136579276-136579298 GCTAGGATGGGCCCGCCCTCAGG + Intergenic
997780043 5:136647940-136647962 ACTAAGTTTGGCCTACCCTCAGG + Intergenic
998094921 5:139391588-139391610 CCTCAGCTGGGCCCACCATCAGG + Exonic
999177686 5:149642885-149642907 ACTAAGCTTGTCCCTGACTCAGG + Intergenic
1002338945 5:178501836-178501858 ACTAATCAGGGCCCTGCCTTGGG + Intronic
1006503544 6:34473498-34473520 CCTAATCTGGGCCTTCCCTGAGG + Intronic
1013820159 6:114145171-114145193 ACAAAGCTAAGCCCTGCCTCCGG - Intronic
1019042167 6:169116321-169116343 ACCAGGCTGGGCATTCCCTCAGG - Intergenic
1020290581 7:6719581-6719603 TGGAAGCTGCGCCCTCCCTCCGG + Intergenic
1024494654 7:50030739-50030761 ACTAAGCTGGACGGTTCCTCTGG + Intronic
1025168967 7:56738898-56738920 ACTAAGCTTGACCATCCTTCAGG - Intergenic
1025239441 7:57258801-57258823 ACTCAGCTGGGCCATTCTTCTGG + Intergenic
1025703420 7:63840994-63841016 ACTAAGCTTGACCATCCTTCAGG + Intergenic
1033341512 7:140495781-140495803 ACCAAGCAGGGCCCAGCCTCCGG - Intergenic
1038398864 8:27267846-27267868 GCTGAGCTGGGCCCTGCCTGTGG + Intergenic
1039472989 8:37825752-37825774 AAGAAGCTGTGTCCTCCCTCGGG - Intronic
1040630983 8:49209926-49209948 CCTTAGCTGGGCCGTCCCTGTGG + Intergenic
1042683662 8:71414085-71414107 ACTATGTAGGGCCTTCCCTCTGG - Intronic
1046614758 8:116463785-116463807 ACTAAGCTGTGCCCACACTGGGG - Intergenic
1047288785 8:123510961-123510983 TCCAAGCTTGGCCCTGCCTCAGG - Intronic
1047502746 8:125454601-125454623 ACGGAGCTGGGCCCTGCCTGGGG + Intergenic
1048364850 8:133729830-133729852 AGTGAGCTGAGCCCACCCTCTGG - Intergenic
1049494780 8:142924552-142924574 ACCAGGCTGGGCCAGCCCTCAGG + Intergenic
1053144631 9:35704174-35704196 ACTAAGCTGGGCCCTCCCTCAGG - Exonic
1057741735 9:97717990-97718012 ACTAATCTGAGCCCTAGCTCTGG + Intergenic
1058924458 9:109648686-109648708 ACAAAGCATGGCCCTGCCTCAGG - Intronic
1059255359 9:112925511-112925533 ACTAAGGTGGTCCTTCCCTGTGG - Intergenic
1059329916 9:113528452-113528474 ACTCAACAGGGCCCTCCTTCAGG + Intronic
1061150270 9:128824174-128824196 ACTGAGCTGGCCCCACCCCCAGG - Exonic
1061668273 9:132173239-132173261 CCTAGGCTGGGCCCTGCCTCGGG - Intronic
1062393833 9:136344734-136344756 ACCAGGCTGGCCCCTGCCTCAGG - Intronic
1062396799 9:136355858-136355880 CCTCAGCCGGGCCCTCCCTTGGG + Intronic
1062460992 9:136662519-136662541 AGGATGCTGGGCCCTCCCCCAGG - Intronic
1186611967 X:11146301-11146323 CCACAGCTGGGCCCTCCATCAGG + Intronic
1188595226 X:31892048-31892070 ATTTAGCTGGGCCATCCATCTGG + Intronic
1192099031 X:68244139-68244161 ACTAAGCTTGTTCCTACCTCAGG + Intronic
1195246693 X:103001584-103001606 ACTAAGCTGCGCTCTCCCTGGGG + Intergenic