ID: 1053147817

View in Genome Browser
Species Human (GRCh38)
Location 9:35723864-35723886
Sequence GGCAGGCTTGGAATGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 289}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053147807_1053147817 7 Left 1053147807 9:35723834-35723856 CCTGGTACCTCGGAAGAAGAAAT 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1053147817 9:35723864-35723886 GGCAGGCTTGGAATGGAGACAGG 0: 1
1: 0
2: 1
3: 16
4: 289
1053147806_1053147817 8 Left 1053147806 9:35723833-35723855 CCCTGGTACCTCGGAAGAAGAAA 0: 1
1: 0
2: 0
3: 11
4: 99
Right 1053147817 9:35723864-35723886 GGCAGGCTTGGAATGGAGACAGG 0: 1
1: 0
2: 1
3: 16
4: 289
1053147810_1053147817 0 Left 1053147810 9:35723841-35723863 CCTCGGAAGAAGAAATAGTGGGG 0: 1
1: 0
2: 1
3: 6
4: 115
Right 1053147817 9:35723864-35723886 GGCAGGCTTGGAATGGAGACAGG 0: 1
1: 0
2: 1
3: 16
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053147817 Original CRISPR GGCAGGCTTGGAATGGAGAC AGG Intronic
900803804 1:4754509-4754531 GGGAAGCTTGGAATGGAGATTGG - Intronic
901278420 1:8011240-8011262 GGCAGCCTTTGGATGGAGGCAGG - Intronic
901307276 1:8241688-8241710 GGCAGGCAGGCAGTGGAGACAGG + Intergenic
901784776 1:11617313-11617335 TGCTGGCTTGGGATGGGGACCGG - Intergenic
902198942 1:14819622-14819644 GGCAGGCTGGAAATGCAGGCAGG - Intronic
903832350 1:26182806-26182828 TCCAGCCTTGGGATGGAGACGGG + Intronic
904331059 1:29758057-29758079 GGCAGGCTTTGAATAGAGGAGGG + Intergenic
904818255 1:33221314-33221336 GGCAGGCTTGGGCTGAAGCCAGG + Intergenic
905473065 1:38207508-38207530 GGCAGGCTCCGGAGGGAGACAGG + Intergenic
905662130 1:39735745-39735767 GGCAAGGTGGGAATGGAGAGGGG + Intronic
906274784 1:44507619-44507641 GGCAGGCTTGGAGTGGCGTGGGG + Intronic
907275865 1:53316303-53316325 GGCAGGCTGGGAATGGGGAGGGG + Intronic
907974577 1:59419055-59419077 AGAAGGCTAGGAATAGAGACTGG + Intronic
909991487 1:82227877-82227899 GGCTGACTTGGAATTAAGACTGG - Intergenic
912344206 1:108949203-108949225 GTGAGGCCTGGAATGGAGAAGGG - Intronic
912975699 1:114328436-114328458 TGCAGAATTGGAAAGGAGACTGG - Intergenic
913571109 1:120120731-120120753 GTCTGGCTTGGAATGGATCCTGG + Intergenic
914291919 1:146281709-146281731 GTCTGGCTTGGAATGGATCCTGG + Intergenic
914552963 1:148732492-148732514 GTCTGGCTTGGAATGGATCCTGG + Intergenic
918312228 1:183293015-183293037 GGCAGGCCTGGAATGGTGGTGGG + Intronic
922132868 1:222796316-222796338 GTCAGGCGTGGAATGGTGAGGGG - Intergenic
922726098 1:227923745-227923767 GGCAGGCTTGTCACGAAGACCGG - Intronic
922765639 1:228155289-228155311 GCCAGGCGTGGAATGGGGGCAGG + Intronic
923557167 1:235010230-235010252 GGGAGGCTTGGCATGGAGGGTGG - Intergenic
1062763109 10:42354-42376 CACAGGTTTGGAATGGATACTGG + Intergenic
1063472680 10:6300890-6300912 CGCAGGATTTGAAAGGAGACAGG + Intergenic
1063975530 10:11412533-11412555 GGCAGGCTTGGAGAGGGGGCAGG - Intergenic
1065293214 10:24251632-24251654 GGCAGGTGTGGGATGGAGAGGGG - Intronic
1066310005 10:34186818-34186840 GGAAGGGTTGGAGTGGAGAGGGG - Intronic
1067210318 10:44255488-44255510 GGTAGTCTTGGAATAAAGACAGG - Intergenic
1069405151 10:68091152-68091174 GGTAGGCATGGACTGGAGAAAGG + Intergenic
1069642197 10:69963235-69963257 GGCAGGCCTGGAAAGGAGGTGGG - Intronic
1069944535 10:71976660-71976682 GGCAGGCCTTGAATTCAGACTGG + Intronic
1070062474 10:72997647-72997669 GGTAGCCTTGGAATGGAGGAGGG - Intergenic
1070282422 10:75059380-75059402 GTCAGCCTGGGAAAGGAGACTGG + Intergenic
1070305428 10:75236207-75236229 GGCAGGAGGGGAATGGAGGCAGG - Intergenic
1073218337 10:101849354-101849376 GGAAAGCAGGGAATGGAGACTGG + Intronic
1073592482 10:104770126-104770148 GGCAGGCTTGGGATGGGACCTGG + Intronic
1075074145 10:119339449-119339471 GGCAGACGTGGAGGGGAGACAGG - Intronic
1077896289 11:6456154-6456176 GGCAGTCGTGGAAGGGAGAAAGG - Exonic
1079243205 11:18735305-18735327 GGCAGGGATGGAGAGGAGACAGG + Intronic
1079246733 11:18757709-18757731 AGCAGGGGTGGACTGGAGACTGG + Intronic
1080739597 11:35051193-35051215 GGCAAGCTTGGAAACAAGACGGG - Intergenic
1083486004 11:62983458-62983480 GGCAGGCTGGGAGGGGAGGCTGG + Intronic
1083675238 11:64321521-64321543 TGGAGGCTGGGCATGGAGACAGG - Intronic
1084022646 11:66426758-66426780 GGGAGGCTTGGATGGGAGCCTGG + Intergenic
1084023934 11:66436204-66436226 GGCAAGCTGGGCTTGGAGACAGG - Intronic
1084487085 11:69454831-69454853 GGCAGACTTGCAATGAAGCCAGG + Intergenic
1084729456 11:71064208-71064230 GCCAGGCTTGGGCTGGAGAGGGG + Intronic
1086170185 11:83827095-83827117 GGCAGGTATGGCATGGTGACTGG + Intronic
1086497708 11:87421361-87421383 GGCAGGCAGGGAAAGGAGATGGG + Intergenic
1088194901 11:107263494-107263516 GACAGGCTAGGAGGGGAGACAGG + Intergenic
1088551158 11:111013688-111013710 GGCTGGCTTGGAGTGGGGAGAGG + Intergenic
1088814457 11:113411692-113411714 GGTAGGCTAGGATTGGAGCCAGG - Intronic
1089299660 11:117490912-117490934 GGCAGGCTGGGGCTGGAGGCAGG + Intronic
1089592018 11:119547717-119547739 GTCAGGCGTGGAATGGTGAAAGG - Intergenic
1089643229 11:119861242-119861264 GGCAGTCATGGGTTGGAGACTGG - Intergenic
1090264409 11:125344989-125345011 GTCAGGCTTGGAGTGGGGCCTGG - Intronic
1090413956 11:126528119-126528141 GGAGGGCTTGGAATGCAGATGGG - Intronic
1091583417 12:1802258-1802280 GGCAGGTGGGCAATGGAGACAGG - Intronic
1092177338 12:6419220-6419242 GGCAGGTTGGGAATGGAACCTGG - Intergenic
1093491557 12:19710731-19710753 AGCAGGGTTGGCATGGAGAGGGG + Intronic
1094056509 12:26274208-26274230 TGCAGGCTGGGAAAGAAGACAGG + Intronic
1094708986 12:32942305-32942327 TGTAGGCTGGCAATGGAGACTGG + Intergenic
1095145569 12:38721987-38722009 GGCAGGCGTGGGATGCAGGCTGG + Intronic
1096510592 12:52125776-52125798 GGCAGGCCTGGATTTGGGACTGG + Intergenic
1096980257 12:55724508-55724530 GGCAGGCTTGGGAAGGACCCAGG - Exonic
1097280601 12:57843664-57843686 GGCAGGCAAGGCATGGAGATGGG + Intronic
1098154093 12:67579320-67579342 AGCAGGCCTGGAATGAAGAGAGG - Intergenic
1099554323 12:84091830-84091852 GGCAGGCGTGGGATCCAGACTGG - Intergenic
1099683204 12:85855432-85855454 GGCAGGCATGGGATGTGGACTGG - Intergenic
1101131940 12:101698320-101698342 GGGAGGCTTGGGATGGTCACGGG - Intronic
1101733755 12:107447460-107447482 GGCAGGGCTGGAAGGGGGACAGG - Intronic
1103996750 12:124834982-124835004 GGCAGACCTGGCATGGAGCCTGG - Intronic
1104286739 12:127431007-127431029 GGGAGCCTTGGGATGGAGCCTGG - Intergenic
1104788440 12:131466761-131466783 GGCAGGCATGGGAGGGTGACTGG - Intergenic
1104857930 12:131910497-131910519 AGCAGGCTTGGGATGGGGATGGG + Intronic
1105624156 13:22096956-22096978 GGCAGGATGGGAAAGGACACTGG - Intergenic
1105637145 13:22226524-22226546 GACAAGGTTGGGATGGAGACTGG - Intergenic
1107880791 13:44830366-44830388 GGCAGGCTTGGAGGGGAAAAGGG - Intergenic
1108848204 13:54699981-54700003 GGCAGGCATGGAGTGGTGAGGGG + Intergenic
1109188693 13:59300097-59300119 GGCAGGCATAGACTGGACACAGG - Intergenic
1112527376 13:100164346-100164368 GGCAGGCTCGGATAGGAGAGTGG + Intronic
1113735640 13:112677262-112677284 GGCAGAGATTGAATGGAGACCGG + Intronic
1113800615 13:113084625-113084647 CACAGGCGTGGAGTGGAGACGGG - Intronic
1114907988 14:27153920-27153942 GGCAGGCTGAGCAGGGAGACAGG - Intergenic
1116806104 14:49495264-49495286 GGCAGGCTCAGAAAGGAAACTGG - Intergenic
1117015556 14:51513764-51513786 GGAAGGCATGGGATGGATACAGG - Intronic
1117919461 14:60714024-60714046 GGAAGGCTTGGAAAGGAGCCTGG - Exonic
1118900671 14:69982790-69982812 GGCTGGGTTTGAATGGAGATGGG + Intronic
1119605272 14:76010370-76010392 GGCAGGGTTGGTATGGAGGAGGG - Intronic
1119735034 14:76976323-76976345 GGCAGGGCTGGGCTGGAGACTGG - Intergenic
1121048297 14:90803677-90803699 GGGAGGCTTGGCATGAAGCCTGG - Intronic
1122829592 14:104389318-104389340 GGCAGGCTGGGGATGGCAACAGG - Intergenic
1122946769 14:105014824-105014846 TGCAGGCTTGGGATTGAGATAGG - Intronic
1124577528 15:30923020-30923042 TGCAGGGCTGGAATAGAGACAGG - Intronic
1125928491 15:43582946-43582968 GGAAAGCCTGGGATGGAGACAGG + Exonic
1125941657 15:43682781-43682803 GGAAAGCCTGGGATGGAGACAGG + Intergenic
1126369413 15:47929672-47929694 GGCAGGATTGCTCTGGAGACAGG - Intergenic
1126561928 15:50053432-50053454 AGCAGGCTTGAAATGCAGACTGG - Intronic
1126713074 15:51483344-51483366 TGTAGGCTTGGAATGAAGACGGG - Intronic
1128233648 15:66052538-66052560 GGCAGGCCTGGAATAGACAGGGG - Intronic
1128456658 15:67835077-67835099 GGCAGGCTTGGAAAGGAAGGCGG + Intergenic
1128682043 15:69659549-69659571 GGCAGGCTGGGAAGGGAAAAGGG - Intergenic
1129239999 15:74245439-74245461 AGCAGGCTTGGCAGGGAGGCTGG + Intronic
1129382933 15:75178989-75179011 GGCAGGCTGTGACTGGAGCCGGG + Intergenic
1129461591 15:75702613-75702635 AGGAGGCCTGGAAAGGAGACTGG - Intronic
1129738608 15:77979100-77979122 CCCAGGCTTGGGGTGGAGACTGG - Intergenic
1130254439 15:82319398-82319420 CCCAGGCTTGGGGTGGAGACTGG - Intergenic
1130436402 15:83903995-83904017 GGCAGGCTTGGAATGAATATGGG - Intronic
1130600526 15:85270572-85270594 CCCAGGCTTGGGGTGGAGACTGG + Intergenic
1130872642 15:87983403-87983425 GGTAGGCATGGAATGGAGCAGGG + Intronic
1135056455 16:19236028-19236050 GGGAGCATTGGCATGGAGACAGG + Intronic
1135588422 16:23688854-23688876 GGGAGGCCTGGGATGGAGAGAGG - Intronic
1136359871 16:29772109-29772131 GGCAGGGTAAGAGTGGAGACAGG - Intergenic
1137830315 16:51537948-51537970 GGCAGGTTTGCAATGGGGACAGG - Intergenic
1139503536 16:67387546-67387568 GACAGGTCTGGGATGGAGACTGG + Intergenic
1139901151 16:70329678-70329700 AGCAGGCCTGGGATGGGGACAGG - Intronic
1139942187 16:70613328-70613350 GGCAGGCTTGTAGCGTAGACTGG + Intronic
1142060047 16:88023364-88023386 GGCCGGCTTGGCCTGGAGGCTGG + Intronic
1142567705 17:851340-851362 GGCAGCCTTGGGCTGCAGACGGG + Intronic
1142590908 17:1005578-1005600 GGCAGGCTGGGAAGGAAGAGCGG + Exonic
1145996429 17:29107327-29107349 GGCAGGCCTAGAAAGGAGAGGGG + Intronic
1146183755 17:30712094-30712116 GGCAGGCTGGGAATAGAAGCTGG - Intergenic
1146911608 17:36651826-36651848 GATAGGCTGAGAATGGAGACAGG + Intergenic
1147327424 17:39676192-39676214 AGCAGGCTTGGGCTGGAGACGGG + Intronic
1147462454 17:40582039-40582061 GGCAGATTTGGTATGGACACAGG + Intergenic
1148676821 17:49450642-49450664 GAGAGGCATGGGATGGAGACAGG + Intronic
1149267925 17:54947960-54947982 GGCAGGTTGAGAGTGGAGACTGG - Intronic
1150484672 17:65535635-65535657 GCCAGGCTTGGATTGGAGAAGGG + Exonic
1150868733 17:68880781-68880803 GGCAGGCTTGGGATCCAGGCTGG + Intronic
1150952945 17:69822680-69822702 GGCAGGCGTGGGATCCAGACTGG + Intergenic
1151560731 17:74868156-74868178 GGCTGGCCTGGGATGGAGAGAGG - Intronic
1151818118 17:76481539-76481561 GGGAGGGCTGGAATGGAGACCGG + Exonic
1151884149 17:76913532-76913554 GGGAGGTGTGGCATGGAGACAGG + Intronic
1152029115 17:77830783-77830805 GCCAGGCTGGGAAGGGACACTGG - Intergenic
1152133675 17:78491949-78491971 GTCAGGCATGGAATGGAGCAAGG + Intronic
1152321803 17:79611922-79611944 GGGAGGCTGGGACTGGGGACAGG - Intergenic
1152956018 18:42685-42707 CACAGGTTTGGAATGGATACTGG + Intergenic
1153724112 18:7937509-7937531 GGCAGGCATGGAATCCAGGCCGG + Intronic
1156499416 18:37547695-37547717 GCCCAGCTTGGAAGGGAGACGGG - Intronic
1156721254 18:40072707-40072729 GGGAGTCTTGGAAAGGACACAGG + Intergenic
1157689880 18:49672782-49672804 GGAAGGCTTGGAGAGGGGACAGG + Intergenic
1157881088 18:51321680-51321702 GCCAGGATTGGAAAGGACACAGG - Intergenic
1158982394 18:62776276-62776298 GGCAGGCTGGAAATGTAGACAGG + Intronic
1161451877 19:4350778-4350800 GCGAGGCTTGGGCTGGAGACAGG + Intronic
1162779357 19:12998601-12998623 GGCAGGGTTGGGATGGGGATGGG - Intronic
1162975041 19:14203659-14203681 GGCAGGCTGGGAATAGAAGCTGG + Intronic
1165803842 19:38568410-38568432 GCCAGGCCTGGAGGGGAGACAGG - Intronic
1165966203 19:39582994-39583016 GGCAGGCTTGGGTGGGGGACAGG - Intergenic
1165971861 19:39638468-39638490 GGCAGCCTTGGGTGGGAGACAGG - Intergenic
1166377806 19:42337337-42337359 GGCAAGCCTGGGATGGAGATGGG + Intronic
1166868175 19:45853765-45853787 GGCAGGGCTGGGATGGAGAAGGG - Intronic
1167101929 19:47409055-47409077 TGCAGGGTGGGAATGGAGAGAGG - Intronic
1167958226 19:53085162-53085184 AGCATGCTGGGAATGAAGACAGG - Intronic
1168516886 19:57016526-57016548 GCCAGGCTGGGATTGGTGACTGG - Intergenic
926523107 2:13942445-13942467 TGCATGAATGGAATGGAGACTGG + Intergenic
929005537 2:37389619-37389641 GGCAGGCCTTGAATGAGGACAGG - Intergenic
929014705 2:37482492-37482514 GGCAGGCATGGGATCGAGTCTGG + Intergenic
932073687 2:68644334-68644356 GGCAGGCTTGGAACCCAGGCGGG - Intronic
932429922 2:71668019-71668041 AGCAGCCTTGGGATGGTGACAGG + Intronic
932579183 2:72982602-72982624 GGCAGGCTTGGAAACAACACGGG + Intronic
932722174 2:74146396-74146418 GGCAGACTGGGAATGGAGTGTGG + Intronic
933650708 2:84847681-84847703 GGAAGGATTTGAATGGAGAAAGG - Intronic
934067564 2:88353813-88353835 GGGAGGCTGGGACAGGAGACTGG + Intergenic
934579213 2:95425143-95425165 GGCAGGCTGGGAATGGGAAGGGG - Intergenic
934600233 2:95651581-95651603 GGCAGGCTGGGAATGGGAAGGGG + Intergenic
934756491 2:96828099-96828121 GGCAGGGTTGAAGTGGAGATCGG + Exonic
934855118 2:97724713-97724735 GCGAGGCTTGGAATGGGGGCGGG + Intronic
935484612 2:103638227-103638249 GTCAGGCTTGGACTTGAGCCCGG + Intergenic
938264426 2:129916366-129916388 GGCAGCCATGGCATGGAGGCTGG + Intergenic
939023463 2:136985204-136985226 AGCAGGATTGGAAGGGAGCCAGG + Intronic
941213020 2:162666813-162666835 GCCAGGCTTGGGATGGACAGTGG - Intronic
941695576 2:168547736-168547758 AGCAGGCTGAGAATGGTGACCGG - Intronic
946417981 2:219550142-219550164 GGCAGGCTTGGAGGGGACGCTGG + Exonic
947565352 2:231189876-231189898 GGGAGGCCTGGGATGGAGGCTGG + Intergenic
947571123 2:231235472-231235494 CACTGGCTTGGAATGGAGAGAGG - Intronic
948803550 2:240443459-240443481 TGCAGGCTTGGCAGGGTGACAGG + Intronic
1170043729 20:12064637-12064659 GTCAGGCATGGAATGGCGAGGGG + Intergenic
1170157104 20:13278991-13279013 GGTAGGAGTGGAATGGTGACAGG - Intronic
1171435588 20:25120590-25120612 GGCAGGGGTGGAATGGGGAAGGG + Intergenic
1172025035 20:31942791-31942813 GGCAGTTTAGGAATGGAGCCAGG + Intronic
1175001220 20:55632662-55632684 GGCAGGCATGGGATTGAGACCGG - Intergenic
1175111973 20:56654812-56654834 GGCTGGCGTGGAATGGACAGGGG - Intergenic
1175312747 20:58023411-58023433 TGCAGGCTTGGGATCCAGACTGG - Intergenic
1176026273 20:62987137-62987159 TGCAGGCTGGGATAGGAGACTGG - Intergenic
1179390968 21:40990669-40990691 GGCAGGCTTGGCTTTGAGGCAGG + Intergenic
1179540397 21:42079780-42079802 GGCAGGCTGGGGATGTGGACCGG + Intronic
1182028828 22:27141446-27141468 GGGAGGTTTGGGGTGGAGACAGG - Intergenic
1182047127 22:27284078-27284100 AGCAGACTTAGAATGAAGACAGG + Intergenic
1182062959 22:27410895-27410917 GGCAGGCTGGGGAAGGAGCCTGG + Intergenic
1182098794 22:27643517-27643539 GGCAGCCTTGGAGATGAGACTGG + Intergenic
1182246504 22:28962363-28962385 GGTAGGCTTGGAGTGCAGAGGGG + Intronic
1183451001 22:37895064-37895086 GGCAGGCTGGGGGTGGGGACGGG - Intergenic
1183518894 22:38284777-38284799 GGCAGGCAGTGAATGGAGAGGGG + Intergenic
1184865688 22:47200795-47200817 GGCAGGCGTGGGATCCAGACCGG - Intergenic
1185230044 22:49674711-49674733 AGCTGGCTTGGCATGGAGTCTGG - Intergenic
949380136 3:3435271-3435293 GGCAGGCTTATACAGGAGACAGG - Intergenic
950455861 3:13092425-13092447 GGCAGGCCTGGGAAGGAGCCAGG - Intergenic
950577735 3:13842850-13842872 GGCAGGTCTGGGCTGGAGACTGG + Intronic
951637275 3:24793531-24793553 GGCAGGGTTGGAGAGGAGATGGG + Intergenic
952951404 3:38528375-38528397 TGGAGGCTAGGCATGGAGACAGG - Intronic
953534879 3:43769875-43769897 GCCGTGCTTGGAATGGAGCCAGG - Intergenic
954465586 3:50652723-50652745 GGCAGGGCTGCAATGAAGACAGG + Intergenic
957307888 3:78481261-78481283 GCCAGGCATGGAATGGCGAGGGG - Intergenic
957653059 3:83034883-83034905 GGCAGGCGTGGAATCCAGGCTGG - Intergenic
963055216 3:141181014-141181036 CACAGGCTGGAAATGGAGACAGG - Intergenic
963483484 3:145905140-145905162 GTCAGGCATGGAATGGTGAGGGG - Intergenic
963910586 3:150814147-150814169 GGCAAGATGGGAATGGACACAGG + Intergenic
965997559 3:174903417-174903439 GGAAGGCTTGGAATGGAGAAGGG + Intronic
966888735 3:184391037-184391059 GGCTGGTTTGGAATGAAGGCAGG + Intronic
967138126 3:186529696-186529718 TGCAAGCTAGGAATGCAGACTGG - Intergenic
967212813 3:187183869-187183891 GCCAGGATTTGAATGCAGACAGG + Intergenic
968358325 3:198125551-198125573 GACAGGGTTGGAATGGATAGTGG - Intergenic
969571315 4:8010360-8010382 GGCGGGCTGGGGACGGAGACGGG - Intronic
969878503 4:10154060-10154082 GGCAGGCTTAAGATGGAGAAAGG + Intergenic
971411024 4:26372718-26372740 GAAAGGTTTGGAATTGAGACTGG - Intronic
971522045 4:27566092-27566114 GGCAGGTCAGGAATGGAGATGGG + Intergenic
971548789 4:27922037-27922059 GGCAAGCTTTAAATGTAGACAGG + Intergenic
972739025 4:41873638-41873660 GGGAGGCTGGGAAGGGAGAGGGG - Intergenic
973816820 4:54626839-54626861 TGGAGGCTTGGACTTGAGACTGG - Intergenic
975910394 4:79259526-79259548 GGCAGGCATGGGATCCAGACTGG + Intronic
979837439 4:125388874-125388896 GGCAGGCTTGGAGAGTAGCCAGG - Intronic
983934916 4:173494999-173495021 GGCAGCGTTGGAAAGGAGTCAGG + Intergenic
984382074 4:179007439-179007461 TGCAGGCATGGAATGGAGTGAGG + Intergenic
985781056 5:1872097-1872119 GGCAGACTTGGAAGGGGGCCTGG - Intergenic
990531682 5:56680123-56680145 GGCAGACATGGAATCAAGACAGG - Intergenic
992691695 5:79247054-79247076 GGCAGGCTTGGATTTGAATCCGG - Intronic
993620559 5:90162873-90162895 TCCAGGCTGAGAATGGAGACTGG + Intergenic
994245270 5:97470344-97470366 GTCAGGCATGGAATGGTGAGGGG + Intergenic
998403146 5:141858494-141858516 TGGAGGCTTGGACTGGGGACTGG + Intronic
1000215715 5:159154019-159154041 GGTAGGTTTGGGATGGAGCCTGG - Intergenic
1000991771 5:167918535-167918557 GGCAGGACTGGAATTGACACTGG + Intronic
1002041035 5:176514387-176514409 GGCGGGCTTGGATTTGAGAAAGG - Intergenic
1002300647 5:178255709-178255731 GGCAGGCTGTGACTGGGGACGGG - Intronic
1002465835 5:179408015-179408037 GGGAGGCTGGGGATGGACACTGG - Intergenic
1003474668 6:6470470-6470492 GGGAGGCAAGGCATGGAGACAGG - Intergenic
1006177571 6:32131615-32131637 AGAAGTCCTGGAATGGAGACTGG + Intergenic
1006454727 6:34125312-34125334 GGGGGGTTTGGAATGGAGGCAGG - Intronic
1007116612 6:39347667-39347689 GGCAGGCTAGGGTTAGAGACAGG + Intronic
1007128254 6:39445827-39445849 GAAGGGCTTGGCATGGAGACTGG + Intronic
1007171969 6:39870458-39870480 CACAGGTTTGCAATGGAGACGGG - Intronic
1007392355 6:41557009-41557031 GCCGGGCTTGAAATGGAGAGAGG - Intronic
1008330527 6:50239966-50239988 GGCAGGCGTGGAATCCAGACCGG - Intergenic
1012545106 6:100410622-100410644 GGCAGGCTTGGCAGGTGGACTGG + Intronic
1013215014 6:108019343-108019365 GGCAGGTGGGGAATGTAGACTGG - Intergenic
1013679913 6:112513680-112513702 TGAAGGCATGGAAGGGAGACAGG + Intergenic
1013964059 6:115934528-115934550 GGGAGGCTTGGAAAGGACATGGG + Exonic
1016608481 6:145962148-145962170 GGGAAGATTGGGATGGAGACAGG - Intronic
1019226191 6:170511854-170511876 GGCAGTCTGGCTATGGAGACAGG + Intergenic
1020094560 7:5361326-5361348 GGCAGGCGTGGCAGGAAGACAGG + Intronic
1020214267 7:6177667-6177689 GGCTCGCTTGGTATTGAGACGGG + Intronic
1020635582 7:10692347-10692369 GTCAGGCAGGGCATGGAGACGGG + Intergenic
1022148668 7:27575467-27575489 GGCAGGCTGAGAAGGAAGACTGG + Intronic
1022626853 7:32045365-32045387 GGCAATCTTGGAATGTAAACTGG + Intronic
1022734023 7:33059410-33059432 GGCAGGTTTGGAAAGTAGCCAGG - Intronic
1025200409 7:56958097-56958119 GGCAGGAGGGGAAAGGAGACAGG - Intergenic
1025671534 7:63618835-63618857 GGCAGGAGGGGAAAGGAGACAGG + Intergenic
1026138382 7:67683446-67683468 AGCAGGGTTGGCTTGGAGACTGG - Intergenic
1027124569 7:75547119-75547141 GGCAAGCTTGGAATGGGAAAGGG + Intronic
1027330991 7:77092461-77092483 GGCAGAGTTGGAATGGATTCTGG + Intergenic
1028154450 7:87413988-87414010 GGCAGGCTGGGAATAGAACCAGG - Intronic
1029973647 7:104813573-104813595 GTCAGGCATGGAATGGCGAGAGG + Intronic
1030223103 7:107118756-107118778 GGTTGGCTTGGAAAGGAGATTGG + Intronic
1031186405 7:118485265-118485287 ACCAGGATTGGCATGGAGACAGG + Intergenic
1033012583 7:137638088-137638110 GGCAGGCTTGGAAAGGGGTAAGG - Intronic
1034073862 7:148213558-148213580 GGCAGGCTAGAGATGGAGGCTGG - Intronic
1034377435 7:150658608-150658630 GGAAGGCATGGAATGGAGTAGGG + Intergenic
1035359748 7:158303286-158303308 GGCTGGTGTGGAATGGAGAGCGG - Intronic
1035479390 7:159169865-159169887 GGCAGCATTGGGATGGAGCCCGG - Intergenic
1035596618 8:863208-863230 GGCAGGATTGGACTGGAAATTGG + Intergenic
1038546099 8:28426761-28426783 GGAAGGCTGGGAAGGGAGAGAGG + Intronic
1039081599 8:33739293-33739315 AGCAGGCCTGAAATGGAGACTGG + Intergenic
1041619105 8:59944530-59944552 GGCAGGCGTGAAATGGTGAGGGG - Intergenic
1042118248 8:65455989-65456011 TTCAGGCTTGGAATGGAGATGGG - Intergenic
1042642604 8:70952648-70952670 TGAAGGCCTGGGATGGAGACAGG + Intergenic
1043193277 8:77254705-77254727 GGAAGGCTGGGAATTGATACAGG + Intergenic
1045781262 8:105865817-105865839 GGTAAGATTGGAATGGAAACTGG - Intergenic
1046966212 8:120168584-120168606 GGCAGGCTTTGAATTTAGGCAGG - Intronic
1047296262 8:123572951-123572973 TGCAGGCTTGGAAAGAAGTCAGG - Intergenic
1047523632 8:125614826-125614848 AGCAGGCTAGGAATGGAGCCAGG - Intergenic
1048483280 8:134822347-134822369 TGGAAGCTGGGAATGGAGACTGG - Intergenic
1049928974 9:438045-438067 GGCAGGTTTGGAAGAAAGACTGG + Intronic
1049941118 9:546869-546891 GTCAGGCTTGGAAAAAAGACAGG + Intronic
1053147817 9:35723864-35723886 GGCAGGCTTGGAATGGAGACAGG + Intronic
1053291875 9:36885628-36885650 GGCAGGCTTGCAAGCCAGACTGG - Intronic
1055410203 9:76020903-76020925 GGCAGGTTTTGAAAGGAGAATGG + Intronic
1056568504 9:87796010-87796032 GCCAGGCTTGGCATGGAGGGTGG + Intergenic
1059655963 9:116357759-116357781 GCCAGTCTTGGGATGGGGACGGG + Intronic
1060128755 9:121075165-121075187 GGCCGGCTTGGGATGGATTCGGG + Intronic
1062138834 9:134944336-134944358 GGCAGGCTGGGGATGGGGAGAGG - Intergenic
1186850581 X:13575938-13575960 GGCTGGCTTTCAATGGAGTCAGG + Intronic
1187672752 X:21685122-21685144 TGCAGACTTGGAATGGAGGATGG + Intergenic
1188119567 X:26287401-26287423 GGCTATCTTGGAATGGAGCCAGG + Intergenic
1188769043 X:34130791-34130813 GGGAGGCTGCGAGTGGAGACTGG + Exonic
1189247337 X:39573566-39573588 GGCAGGGTGGGAAGGGAGTCAGG + Intergenic
1189258233 X:39657158-39657180 GAAAGGTCTGGAATGGAGACTGG + Intergenic
1190495910 X:51028475-51028497 GGTAGGGTTTGAATGGAAACAGG - Intergenic
1190621320 X:52289158-52289180 GGCAGGCCTGGAATCTGGACTGG + Intergenic
1192201638 X:69069975-69069997 GGATGGCATGGAAGGGAGACAGG + Intergenic
1195383023 X:104288841-104288863 TGCAGGCTTGGATTTGTGACTGG + Intergenic
1197335594 X:125206029-125206051 GGCAGGCTTGGAGTCGTGGCTGG + Intergenic
1198277737 X:135112516-135112538 GGAAGGCCTGGAAGGGAGATAGG + Intergenic
1198395132 X:136212491-136212513 GACAGGCCTGGGATGGAGAGGGG + Intergenic
1198633967 X:138674700-138674722 GGGATGCTTGAAATGGAGATGGG + Intronic
1199359896 X:146906305-146906327 GTCAGGCCTGGAGTGGAGAGGGG + Intergenic
1199695120 X:150338542-150338564 TGCAGGGTTGTGATGGAGACTGG - Intergenic