ID: 1053147817

View in Genome Browser
Species Human (GRCh38)
Location 9:35723864-35723886
Sequence GGCAGGCTTGGAATGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 289}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053147810_1053147817 0 Left 1053147810 9:35723841-35723863 CCTCGGAAGAAGAAATAGTGGGG 0: 1
1: 0
2: 1
3: 6
4: 115
Right 1053147817 9:35723864-35723886 GGCAGGCTTGGAATGGAGACAGG 0: 1
1: 0
2: 1
3: 16
4: 289
1053147806_1053147817 8 Left 1053147806 9:35723833-35723855 CCCTGGTACCTCGGAAGAAGAAA 0: 1
1: 0
2: 0
3: 11
4: 99
Right 1053147817 9:35723864-35723886 GGCAGGCTTGGAATGGAGACAGG 0: 1
1: 0
2: 1
3: 16
4: 289
1053147807_1053147817 7 Left 1053147807 9:35723834-35723856 CCTGGTACCTCGGAAGAAGAAAT 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1053147817 9:35723864-35723886 GGCAGGCTTGGAATGGAGACAGG 0: 1
1: 0
2: 1
3: 16
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053147817 Original CRISPR GGCAGGCTTGGAATGGAGAC AGG Intronic