ID: 1053151077 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:35743491-35743513 |
Sequence | GATGAGGCAGAGAGGGATCT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1053151072_1053151077 | -6 | Left | 1053151072 | 9:35743474-35743496 | CCTCAGGATACCTAAGGGATGAG | 0: 1 1: 0 2: 2 3: 3 4: 115 |
||
Right | 1053151077 | 9:35743491-35743513 | GATGAGGCAGAGAGGGATCTTGG | No data | ||||
1053151071_1053151077 | -5 | Left | 1053151071 | 9:35743473-35743495 | CCCTCAGGATACCTAAGGGATGA | 0: 1 1: 0 2: 0 3: 8 4: 107 |
||
Right | 1053151077 | 9:35743491-35743513 | GATGAGGCAGAGAGGGATCTTGG | No data | ||||
1053151070_1053151077 | -4 | Left | 1053151070 | 9:35743472-35743494 | CCCCTCAGGATACCTAAGGGATG | 0: 1 1: 0 2: 0 3: 4 4: 83 |
||
Right | 1053151077 | 9:35743491-35743513 | GATGAGGCAGAGAGGGATCTTGG | No data | ||||
1053151067_1053151077 | 1 | Left | 1053151067 | 9:35743467-35743489 | CCATTCCCCTCAGGATACCTAAG | 0: 1 1: 0 2: 3 3: 13 4: 205 |
||
Right | 1053151077 | 9:35743491-35743513 | GATGAGGCAGAGAGGGATCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1053151077 | Original CRISPR | GATGAGGCAGAGAGGGATCT TGG | Intronic | ||
No off target data available for this crispr |