ID: 1053151077

View in Genome Browser
Species Human (GRCh38)
Location 9:35743491-35743513
Sequence GATGAGGCAGAGAGGGATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053151072_1053151077 -6 Left 1053151072 9:35743474-35743496 CCTCAGGATACCTAAGGGATGAG 0: 1
1: 0
2: 2
3: 3
4: 115
Right 1053151077 9:35743491-35743513 GATGAGGCAGAGAGGGATCTTGG No data
1053151071_1053151077 -5 Left 1053151071 9:35743473-35743495 CCCTCAGGATACCTAAGGGATGA 0: 1
1: 0
2: 0
3: 8
4: 107
Right 1053151077 9:35743491-35743513 GATGAGGCAGAGAGGGATCTTGG No data
1053151070_1053151077 -4 Left 1053151070 9:35743472-35743494 CCCCTCAGGATACCTAAGGGATG 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1053151077 9:35743491-35743513 GATGAGGCAGAGAGGGATCTTGG No data
1053151067_1053151077 1 Left 1053151067 9:35743467-35743489 CCATTCCCCTCAGGATACCTAAG 0: 1
1: 0
2: 3
3: 13
4: 205
Right 1053151077 9:35743491-35743513 GATGAGGCAGAGAGGGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053151077 Original CRISPR GATGAGGCAGAGAGGGATCT TGG Intronic
No off target data available for this crispr