ID: 1053151756

View in Genome Browser
Species Human (GRCh38)
Location 9:35748313-35748335
Sequence CCAAAGGCATTCTAGGCAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 194}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053151749_1053151756 16 Left 1053151749 9:35748274-35748296 CCACCTCTGCTAGAAGTTTTGAG 0: 1
1: 0
2: 0
3: 11
4: 117
Right 1053151756 9:35748313-35748335 CCAAAGGCATTCTAGGCAATGGG 0: 1
1: 0
2: 2
3: 15
4: 194
1053151748_1053151756 17 Left 1053151748 9:35748273-35748295 CCCACCTCTGCTAGAAGTTTTGA 0: 1
1: 0
2: 2
3: 14
4: 170
Right 1053151756 9:35748313-35748335 CCAAAGGCATTCTAGGCAATGGG 0: 1
1: 0
2: 2
3: 15
4: 194
1053151746_1053151756 23 Left 1053151746 9:35748267-35748289 CCCTTTCCCACCTCTGCTAGAAG 0: 1
1: 0
2: 2
3: 22
4: 278
Right 1053151756 9:35748313-35748335 CCAAAGGCATTCTAGGCAATGGG 0: 1
1: 0
2: 2
3: 15
4: 194
1053151750_1053151756 13 Left 1053151750 9:35748277-35748299 CCTCTGCTAGAAGTTTTGAGCTG 0: 1
1: 0
2: 0
3: 10
4: 113
Right 1053151756 9:35748313-35748335 CCAAAGGCATTCTAGGCAATGGG 0: 1
1: 0
2: 2
3: 15
4: 194
1053151747_1053151756 22 Left 1053151747 9:35748268-35748290 CCTTTCCCACCTCTGCTAGAAGT 0: 1
1: 0
2: 1
3: 24
4: 249
Right 1053151756 9:35748313-35748335 CCAAAGGCATTCTAGGCAATGGG 0: 1
1: 0
2: 2
3: 15
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053151756 Original CRISPR CCAAAGGCATTCTAGGCAAT GGG Intronic
901037874 1:6347147-6347169 GCAAAGCCCTTCTAGGCACTGGG + Intronic
901579952 1:10234068-10234090 CCAAAACCTTTCTAGGGAATAGG + Intronic
903518954 1:23933044-23933066 CAAAAGGCAACCTAGGGAATGGG + Intergenic
905391429 1:37638334-37638356 CAAAAGGCATTCCAGGCAGAGGG + Intergenic
905521316 1:38602819-38602841 GCAAGTGCATTCTAGGCAAAGGG + Intergenic
906634688 1:47401248-47401270 CAAAAAGCATTCCAGGCAGTGGG - Intergenic
907551755 1:55310729-55310751 CCAGAGAAATTCTTGGCAATAGG + Intergenic
908590003 1:65620883-65620905 GCAAAAGCATTCCAGGCAAAGGG + Intronic
909103064 1:71375313-71375335 CCAAGTCCATTCTAGCCAATGGG + Intergenic
910996678 1:93112709-93112731 GCCAAGGCTTTCTAGTCAATTGG + Intronic
911991888 1:104708573-104708595 GAAAAGGCAATCTAGGTAATGGG - Intergenic
913053818 1:115139453-115139475 TCAAAGGCATTAAAAGCAATTGG - Intergenic
913566713 1:120080116-120080138 GCAAGGGCATTATAGGCAAAGGG - Intergenic
913631418 1:120713436-120713458 GCAAGGGCATTATAGGCAAAGGG + Intergenic
914287469 1:146240823-146240845 GCAAGGGCATTATAGGCAAAGGG - Intergenic
914548501 1:148691565-148691587 GCAAGGGCATTATAGGCAAAGGG - Intergenic
914618178 1:149380146-149380168 GCAAGGGCATTATAGGCAAAGGG + Intergenic
917773372 1:178305337-178305359 CCAAAGTCATTCTGAGCAAAAGG + Intronic
917826852 1:178831164-178831186 TTAAAGGCAGTCAAGGCAATTGG + Intronic
917902755 1:179559495-179559517 GCAAAGGCAATCTAGGGAATGGG - Intronic
918106444 1:181419370-181419392 GGAAAAGCATTCTAGGCAAAGGG - Intronic
918132017 1:181637854-181637876 GGAAAGGCATTATAGGCAGTGGG + Intronic
918746540 1:188208609-188208631 CCAAAGGGATCCTATGCAAAAGG + Intergenic
919420590 1:197365475-197365497 CCAGAGGCATCATAGGCAAGGGG - Intronic
919455146 1:197812441-197812463 ACAAAGGAATTGGAGGCAATGGG + Intergenic
919477765 1:198050454-198050476 CCAAAGCCATCCTAAGCAAAAGG - Intergenic
1063533116 10:6855347-6855369 CAAAAGGCATCCTATGGAATTGG - Intergenic
1064825210 10:19391140-19391162 CCACAGGAATTCTATGCCATTGG - Intronic
1065262857 10:23943586-23943608 CAACAGGCATTTTTGGCAATAGG + Intronic
1065999791 10:31093499-31093521 CCATAGGCATTCAAGGCATGAGG - Intergenic
1069536582 10:69257989-69258011 CAAAAGGCATTCCAGGTGATAGG + Intronic
1071905256 10:90166407-90166429 CCAAAGGTATCCTAAGCAAAAGG - Intergenic
1072226525 10:93375186-93375208 CCAAAGCCATTTTAGGCCTTAGG + Intronic
1072904725 10:99442303-99442325 TTAAAGGCATTCTAAGCTATTGG - Intergenic
1072987529 10:100154485-100154507 TCAAAGGCATTCCTGGCATTTGG - Intronic
1077709581 11:4522759-4522781 TGAAAGGCAGTCTAGGCCATGGG + Intergenic
1078624271 11:12939642-12939664 GCAAAGGCATTCTGAGCAAGAGG - Intronic
1078944230 11:16045701-16045723 GCAGGGGCATTCTAGGCACTAGG - Intronic
1079764161 11:24369777-24369799 CAAAAGTCATTCCAGGCAAAAGG + Intergenic
1085496527 11:76975084-76975106 AGAAAGGCATTCTAGGAAGTAGG - Intronic
1090998088 11:131885205-131885227 CCTAATGCATTCCAGGCACTGGG + Intronic
1091032560 11:132204042-132204064 CCAAAAGCATTTCAGGCAAATGG - Intronic
1097348991 12:58526945-58526967 CAAATGGCATTCTAGGCAGATGG + Intergenic
1097640934 12:62181089-62181111 ACAAATACATTCTAGGCAAAAGG - Intronic
1098160362 12:67643678-67643700 CCTAAGGCAATCTAGGTATTTGG - Intergenic
1098463846 12:70764481-70764503 CAAAAGGCATCATGGGCAATGGG + Intronic
1098932568 12:76436895-76436917 ACCAATGCATTATAGGCAATAGG - Intronic
1101670541 12:106867877-106867899 CCAAAGTCAGTCTAGGGATTTGG - Intronic
1101761004 12:107659129-107659151 CTGAAGGCATGCTAGGAAATAGG - Exonic
1103025363 12:117569659-117569681 CCGAAGGGTTTCTAGGCACTTGG + Intronic
1105594856 13:21827807-21827829 GCAAAGGCATTCTAGCCTAGAGG - Intergenic
1106700681 13:32225050-32225072 TAAAAGGCATTCTAGCCAATCGG + Intronic
1107157423 13:37185647-37185669 GGAAAGGCATTTTAGGCAAAGGG + Intergenic
1109409866 13:61948642-61948664 CCAAAGCAATCCTAAGCAATAGG + Intergenic
1110328446 13:74243829-74243851 AGAAGGGCATTCTAAGCAATGGG + Intergenic
1111550573 13:89805700-89805722 CAAGAGCCATTCTAGGCACTAGG + Intergenic
1111798719 13:92956825-92956847 CAAACGGCATTCTAGGCAGAGGG - Intergenic
1115234637 14:31196916-31196938 CCATGGGCATTTTAGGCATTAGG + Intronic
1118034193 14:61849002-61849024 CCAAGGGCTTTTTAGTCAATAGG + Intergenic
1118443826 14:65834618-65834640 CCAAGTGCATTCTTAGCAATGGG + Intergenic
1202926393 14_KI270724v1_random:29866-29888 ATAAAGGCATTATAGGAAATGGG - Intergenic
1125163780 15:36678786-36678808 CAAAAGGCATTCTTTGCAGTAGG + Intronic
1126710316 15:51447637-51447659 CAAAAGCCATTCTAGGAAATGGG - Intergenic
1128198370 15:65781109-65781131 ACAAAGGCATTCCAGGCAGAAGG + Intronic
1131464310 15:92643315-92643337 CCAAAGTCATTATAAGAAATAGG + Intronic
1131558793 15:93421911-93421933 GCAAAGGCATTCTAGGTAGAAGG - Intergenic
1135750542 16:25055262-25055284 CAAAAGGCATTCTAGACAGGAGG - Intergenic
1136176933 16:28523680-28523702 CCAAGTGCCTTTTAGGCAATTGG + Intergenic
1137259393 16:46811826-46811848 CCAAAAGCACTTTAGGCATTTGG + Intronic
1137727801 16:50668850-50668872 CTAAGGGCATTCTAGGCCAAGGG + Intronic
1137999103 16:53255381-53255403 CCAAAGCCATTCTAGGCAGATGG + Intronic
1138089142 16:54159869-54159891 CTAGCGGCATTCTAGGCACTTGG - Intergenic
1138096247 16:54214279-54214301 GCAATGGCATTCTAGGCAGGGGG + Intergenic
1138828907 16:60355175-60355197 CTACAGTCATTTTAGGCAATGGG - Intergenic
1145758266 17:27408670-27408692 CCAAAGGCATTCCTGCCAAGGGG + Intergenic
1146328608 17:31908711-31908733 CAAAAGACATTCCAGGCAAAGGG - Intergenic
1146958909 17:36955556-36955578 CCAAAGGCATACCAGGAATTAGG - Intronic
1150379080 17:64706594-64706616 GCAAGGGCATTCTAGGCAGTGGG - Intergenic
1155107091 18:22678096-22678118 TCAAAGGGATTCTAAGCACTGGG - Intergenic
1157253787 18:46119760-46119782 AGAAGGGCATTCCAGGCAATGGG + Intronic
1158539960 18:58344329-58344351 TCAAGGGCATTCTTGGCATTTGG + Intronic
1159688939 18:71460776-71460798 CATAAGGCATTCTAGGATATTGG + Intergenic
1160287862 18:77562400-77562422 ACAAATGCATTCTAGGTATTAGG - Intergenic
1166346216 19:42167789-42167811 CCATAGGCAATATGGGCAATGGG - Intronic
1166419882 19:42628410-42628432 ACAAAGGCATTCTAGTCCCTAGG - Intronic
1166525826 19:43509014-43509036 GGAAAGGCATTCTAGGCAGATGG + Intronic
927960993 2:27240656-27240678 GCAAAGGCATCCTAGGCAAGAGG - Intronic
928107726 2:28482590-28482612 GAAAAGGCAATCTATGCAATGGG - Intronic
930186591 2:48417969-48417991 GGAAAGGCATTCTAGGCATAGGG - Intergenic
932680958 2:73825234-73825256 CGCAAGCCATTCTAGGCAGTGGG + Intergenic
932704315 2:74011373-74011395 CCGTAGAAATTCTAGGCAATGGG - Intronic
932783648 2:74580463-74580485 GCAAAGACATTCTGGGCACTAGG + Intronic
936064770 2:109322369-109322391 CCACAGGCAGACTAGGCAGTTGG + Intronic
937404925 2:121618203-121618225 CAACAGGCATTATAGGCATTAGG - Intronic
939889541 2:147720349-147720371 CCAAAGTCATTCTCAGCAGTTGG - Intergenic
940666292 2:156614109-156614131 GCAAAGGCAAACCAGGCAATTGG - Intergenic
943867041 2:192938421-192938443 CCAAAGGCACTTTAGTCAGTAGG + Intergenic
945003643 2:205378330-205378352 ACAAAGGGATTCGAGGCCATTGG + Intronic
946320281 2:218949884-218949906 CCAAAGGCAGTCCAGACAAGAGG + Intergenic
948182778 2:235995869-235995891 CCAAACCCATTTTTGGCAATGGG - Intronic
1171129911 20:22642555-22642577 TCAGAAGCATTCTAGGCAGTAGG - Intergenic
1171782204 20:29429375-29429397 GTAAAGGCATTATAGGAAATGGG + Intergenic
1173825339 20:46044523-46044545 GGAAGGGCATTCCAGGCAATGGG + Intronic
1174036696 20:47672892-47672914 GAAAAGGCATTCTAGGCAGAAGG - Intronic
1177577858 21:22982309-22982331 TGAAAGGCAGTCTAGGCCATAGG + Intergenic
1177743255 21:25179199-25179221 CCATAGTCTTTCTAGGCATTGGG - Intergenic
1182171542 22:28234780-28234802 TCAGAGGCATACTAGGTAATTGG + Intronic
1184803106 22:46774490-46774512 CCACAGGTATTCTAAGCAACTGG - Intronic
949155803 3:826459-826481 TGAAAGGCAGTCTAGGCCATAGG + Intergenic
949384536 3:3485702-3485724 CCAAAGTCAGTCTAGGCCACTGG - Intergenic
949432974 3:3998279-3998301 CCACAGGCATTCTATACAATGGG - Intronic
949606492 3:5659574-5659596 ACAAGGGCATTTTAGGCAAAGGG - Intergenic
952897086 3:38084998-38085020 CCAAAGAAATTCTAAGCCATAGG + Intronic
955314906 3:57930138-57930160 CCAAAACCATTGTGGGCAATTGG - Intergenic
955433301 3:58872130-58872152 CAGAAGGCTTTCTAGGTAATGGG - Intronic
955961563 3:64346238-64346260 GTGAAGGCATTCTAGGCAAAAGG + Intronic
956726351 3:72159642-72159664 CCAAGGGCATTCCAGGCAGATGG + Intergenic
957743651 3:84308214-84308236 TCAAAAGCATACTAGGCATTTGG + Intergenic
959842082 3:110988979-110989001 CCAAAGGCATCCTGAGCAAAAGG + Intergenic
960324163 3:116274746-116274768 TCAAGGGCAATCTAGGCAAAAGG + Intronic
961266368 3:125646180-125646202 CCAAACACATTCTAGGTAGTAGG + Intergenic
965048433 3:163611563-163611585 CCAAAACAATTCTAGGCAAAAGG - Intergenic
965253084 3:166368252-166368274 CGAAAGGCATTCTAAGCCACAGG + Intergenic
966479363 3:180388709-180388731 GGAAAGGCATTCTAGGCAATGGG - Intergenic
969096638 4:4737332-4737354 ACAATGACATTCTAAGCAATGGG + Intergenic
970523304 4:16907161-16907183 CAAAGGGCTTTCTAGGGAATTGG - Intergenic
971097373 4:23423062-23423084 GGAAAGGCATTCTAGGCCAGGGG + Intergenic
971500891 4:27316787-27316809 CCAAGGGCATTCTAAGCTAGGGG - Intergenic
972033321 4:34490240-34490262 CAAAAGGAATTCTAGGCAATGGG + Intergenic
972323309 4:37992380-37992402 CCAAATGCCTTCTAGGTAACTGG - Intronic
974623580 4:64393168-64393190 CCAAAAGCCTTCTAGGTAATAGG - Intronic
975848773 4:78551071-78551093 GGAAGGGCATTCTAGGCATTTGG - Intergenic
975994464 4:80298326-80298348 GGAAAGGCATTCCAGGCATTGGG - Intronic
976538730 4:86247794-86247816 GAAAAGGCATTCTAGGGACTGGG + Intronic
977054912 4:92180280-92180302 CCAAAGTCATGCTAAGCAAAAGG + Intergenic
980235223 4:130096791-130096813 CCAAAGGCATTTTAAGCAAAAGG + Intergenic
981721416 4:147805423-147805445 CCAAAGCAATTCTAAGCAAAAGG - Intronic
981916284 4:150037066-150037088 GAAAAGGCTTTCTAGGCAAAGGG - Intergenic
984766748 4:183405739-183405761 CCCAAGGCATTCTAGATAAGGGG - Intergenic
985297635 4:188452571-188452593 TCAAGGGCATTCTAATCAATTGG - Intergenic
988991308 5:36673574-36673596 CCAAAGGCGTTCTGGGGAATGGG - Intronic
989330213 5:40249456-40249478 CCAAAGGTATCCTAAGCAAAAGG + Intergenic
990436442 5:55796711-55796733 GGAAAGGCATTCTAAGCAGTAGG - Intronic
991600475 5:68347329-68347351 CCAATGGCAGCCAAGGCAATAGG - Intergenic
994627686 5:102242251-102242273 TGAAAGGCAGTCTAGGCCATAGG + Intronic
995433872 5:112113565-112113587 CCAAAAGCATTATGGGTAATTGG - Intergenic
996492377 5:124113068-124113090 GCAAAGGCTTTCTAGGCATCAGG + Intergenic
999141695 5:149366663-149366685 CCTAAGTCATACTAGGCACTGGG + Intronic
999470691 5:151852259-151852281 ACAAGGGCATTCTGGGCAAAGGG - Intronic
1000174993 5:158743276-158743298 GGAAAAGCATTCCAGGCAATAGG + Intronic
1000198419 5:158983651-158983673 CCAAAGACATTAGAGCCAATAGG - Intronic
1000232419 5:159328591-159328613 AGAAAGTCATTCTAGGCAGTAGG + Intronic
1000517271 5:162253483-162253505 CCAATGGCATTTTAAGGAATGGG + Intergenic
1000897092 5:166868450-166868472 CCAAATACATGCTAGGCACTAGG + Intergenic
1000909695 5:167007207-167007229 GCATAGTCATTCTAGGCAATGGG - Intergenic
1001165526 5:169362157-169362179 CCAGAGGCATTCTTAGCTATGGG - Intergenic
1001543613 5:172556443-172556465 CCCAAGGCATCCTAGGAAAGGGG - Intergenic
1008315033 6:50029766-50029788 CCAAAGCCATCCTAAGCAAAAGG + Intergenic
1008410167 6:51168464-51168486 CCAAAGCAATTCTAAGCAAAAGG + Intergenic
1008775214 6:55030206-55030228 AAAAAGGCATTCTATGCAAATGG - Intergenic
1010544142 6:77129073-77129095 CCAAAGTCATCCTAAGCAAAAGG + Intergenic
1013317580 6:108957129-108957151 CCTAAGGCATAGTAGGCAAGAGG - Intronic
1014013969 6:116508331-116508353 ACAAAGACATTCTAGGTAGTGGG + Intronic
1014639179 6:123888340-123888362 TAAAAAGCATTCTAAGCAATAGG - Intronic
1015849593 6:137558289-137558311 AAAAAGGCATTCTATGCAAATGG - Intergenic
1017215663 6:151903045-151903067 CCAAAGGCTTGCTAGGAAAGTGG - Intronic
1019781821 7:2944918-2944940 GAAAAGGCATTCTAGGAAAGGGG + Intronic
1020493546 7:8819535-8819557 ACAAACGCATTCTAGGAACTGGG - Intergenic
1020970605 7:14932810-14932832 CCAAAGGGCTTCCAGGCAACTGG + Intronic
1024498219 7:50071421-50071443 TGAAAGGCAATCTAGGCCATAGG + Intronic
1024508318 7:50182221-50182243 CCAAAGCCAATGTTGGCAATTGG + Intergenic
1025246858 7:57324112-57324134 ATAAAGGCATTCTAAGCCATAGG - Intergenic
1026859022 7:73773016-73773038 CCAACACCATTCTAGGCAATAGG - Intergenic
1031467613 7:122132913-122132935 TAAAAGGCATTTGAGGCAATGGG + Intronic
1033070807 7:138200385-138200407 CCAAAGCAATTCTAAGCAAAAGG + Intergenic
1033272490 7:139945124-139945146 CAAAAGGCTTTCTTGGGAATGGG + Intronic
1033817622 7:145094002-145094024 GGAAAGGCATTCTAGACAATGGG + Intergenic
1035911343 8:3570382-3570404 CCACAGGCATTTGACGCAATGGG + Intronic
1036495162 8:9263608-9263630 ACAGAGGCATTCTTGGCAATGGG + Intergenic
1039433174 8:37541655-37541677 ACAAAGGGTTTCTGGGCAATGGG - Intergenic
1040665944 8:49633274-49633296 CCAAAGGCATTCTCAGTAACAGG - Intergenic
1040987211 8:53308568-53308590 CCAGGGGCTTTCTAGGCAAGAGG - Intergenic
1043598886 8:81915917-81915939 CAGGAGGCTTTCTAGGCAATTGG - Intergenic
1045090292 8:98735240-98735262 CAAAAGCTATTCTAGGCACTTGG + Intronic
1047120142 8:121893910-121893932 TCAAAAGCATTCCAGGCAGTAGG - Intergenic
1051449861 9:17183628-17183650 CCAAAGGCATTGAAAGGAATAGG - Intronic
1051807891 9:21016559-21016581 CAGAAGGCATCCTAGGCAAAGGG + Intronic
1053099713 9:35361305-35361327 CCTAAGGCATTTTAGGGAGTTGG + Intronic
1053151756 9:35748313-35748335 CCAAAGGCATTCTAGGCAATGGG + Intronic
1054882357 9:70157847-70157869 CCAAAGGTAAACTAAGCAATAGG + Intronic
1055190309 9:73512322-73512344 CCAAAGCAATTCTAAGCAAAAGG - Intergenic
1059026209 9:110634370-110634392 ACAAAGGCATACCAGGCAAATGG - Intergenic
1059612368 9:115912315-115912337 ACATAGGTTTTCTAGGCAATGGG - Intergenic
1060976035 9:127765634-127765656 GCAAAGACATTCTAGGCAGAGGG - Intronic
1186078645 X:5907315-5907337 CCACAGGAATTTGAGGCAATTGG - Intronic
1186657739 X:11633320-11633342 GCAAAGGCATTCATGGCACTGGG - Intronic
1187252279 X:17609382-17609404 CACAAGGCATTCTAGGCAGAGGG + Intronic
1188111773 X:26202520-26202542 CCAAAGCAATTCTAAGCAAAAGG + Intergenic
1189123201 X:38417247-38417269 CTAAAGGCAATATAGGGAATTGG + Intronic
1191236874 X:58141164-58141186 CCAAAGGCATTCTAAGGATAGGG + Intergenic
1192600530 X:72459025-72459047 AAAAAGGCATTCTAGGCAGAGGG - Intronic
1192940880 X:75910324-75910346 CGAAAGGAAGTCTAGGCCATAGG - Intergenic
1193022671 X:76807684-76807706 CCAAAACCATTCTAAGCAAAAGG + Intergenic
1193697437 X:84725874-84725896 CCAAAGCAATTCTAAGCAAAAGG - Intergenic
1195136108 X:101908813-101908835 TGAAAGGCAGTCTAGGCAATAGG + Intronic
1195769433 X:108334086-108334108 CCAAAGGAATCCTAAGCAAAAGG + Intronic
1196257947 X:113544853-113544875 CATAAGGCATTCTGGGCAAAAGG - Intergenic
1196476770 X:116096199-116096221 CAAAAGGCAATCTATGGAATGGG - Intergenic
1196529446 X:116767546-116767568 CCAAAGCAATTCTAAGCAAAAGG - Intergenic
1199763108 X:150920534-150920556 GCAAAGGCTTTCTAGGCTAAAGG + Intergenic
1199845968 X:151693558-151693580 GGAAAGGCATTCTGGGCAGTGGG + Intergenic
1201749023 Y:17412572-17412594 ACAAAGGCAATCTAGTCTATAGG - Intergenic