ID: 1053152282

View in Genome Browser
Species Human (GRCh38)
Location 9:35750668-35750690
Sequence GTGGAGTAGAAAGGATACAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053152282_1053152287 14 Left 1053152282 9:35750668-35750690 CCAGTGTATCCTTTCTACTCCAC 0: 1
1: 0
2: 0
3: 11
4: 168
Right 1053152287 9:35750705-35750727 TGTGACCTGAGGCTTGATCCTGG 0: 1
1: 0
2: 1
3: 11
4: 149
1053152282_1053152286 3 Left 1053152282 9:35750668-35750690 CCAGTGTATCCTTTCTACTCCAC 0: 1
1: 0
2: 0
3: 11
4: 168
Right 1053152286 9:35750694-35750716 AAATTCTATTCTGTGACCTGAGG 0: 1
1: 0
2: 1
3: 27
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053152282 Original CRISPR GTGGAGTAGAAAGGATACAC TGG (reversed) Exonic
901246774 1:7737929-7737951 GTACAGTAGAAAGGATAGTCAGG - Intronic
901431249 1:9216345-9216367 GTGGAGAAGGAAGAAGACACAGG - Intergenic
907692839 1:56687451-56687473 GTGGGGAGGAAAGGATAAACAGG + Intronic
908483904 1:64571612-64571634 GTGGAGTGGAAAGATGACACTGG - Intronic
910631523 1:89360186-89360208 GGGAGGTAGAAAGGATACAGGGG + Intergenic
914843044 1:151264142-151264164 TTGGAGTAGAAAGGATATGGGGG + Intronic
915971314 1:160357100-160357122 GTGCAGTAGAACGCACACACCGG - Exonic
917512682 1:175681284-175681306 GAGAAGGAGAAAGGAGACACAGG + Intronic
920272559 1:204777070-204777092 GTGAAGTATAAAGGCTACTCTGG + Intergenic
922822981 1:228497153-228497175 GTGGAGTGGAGAGGACACAAGGG - Intergenic
924105818 1:240648140-240648162 GTGGAATAGAGGGGATACAGTGG + Intergenic
1067905261 10:50284212-50284234 GTGGATCAGAAAGGATTCAGTGG - Intergenic
1069770923 10:70899461-70899483 GTGGGGTTGAGAGGATACAGGGG - Intergenic
1075736085 10:124665391-124665413 TTGGAGTGGAGAGGAGACACAGG - Intronic
1077738801 11:4821649-4821671 GGGTAGTAGAAAGTGTACACAGG - Exonic
1078098936 11:8318117-8318139 ATGAAGAAGAAAGGGTACACAGG - Intergenic
1079110096 11:17600532-17600554 GTGAAGTGGAAAGGAGAGACTGG + Intronic
1079783475 11:24639877-24639899 GTGTAAAAGAAAGGACACACAGG - Intronic
1083002947 11:59313455-59313477 GTGGAGTCTAAAGGTCACACTGG + Intergenic
1083160630 11:60852137-60852159 GTGGAGTCGGAAGGGCACACGGG - Exonic
1083163327 11:60868859-60868881 GAGGTGGAGAAGGGATACACAGG - Intronic
1084879936 11:72163694-72163716 GTGGAGAAGAAAGGAAAAAAAGG + Intergenic
1085054792 11:73397306-73397328 GTGGAGAGGAAAGGAGCCACAGG + Exonic
1085846340 11:80070220-80070242 GAGAAATAAAAAGGATACACAGG - Intergenic
1087735135 11:101824190-101824212 GTGGAGCAGAAAGGGCACAGAGG + Intronic
1088321774 11:108562038-108562060 ATGGAGAAGTAAGGAAACACAGG - Intronic
1088360392 11:108983108-108983130 GTGAAATAGAGAGGATACATTGG + Intergenic
1093531062 12:20164483-20164505 GTGGAGGAGAAAGGAGAGAGAGG - Intergenic
1098563512 12:71904507-71904529 GTACAGTAGAAAGGAAAAACTGG + Intronic
1099163051 12:79269314-79269336 GTGGAGCAGAAAGGATTTATAGG - Intronic
1099222488 12:79931803-79931825 GTGGGGGAGAAAGGCTACTCTGG + Intronic
1100686217 12:96988910-96988932 GTATAGTAGAAAGAATTCACAGG + Intergenic
1100769467 12:97905775-97905797 GTGGGGCAGAAGGGATACACAGG + Intergenic
1101787849 12:107901393-107901415 GTGGCAGAGAAAGGAAACACTGG - Intergenic
1103163425 12:118750044-118750066 GTGGAGAAGAAAGGAATCTCTGG + Intergenic
1103243765 12:119437410-119437432 ATGGAGTAGAATGGTTACATGGG + Intronic
1104766735 12:131334787-131334809 TTGGAGTAGAAAGGATGCTGTGG + Intergenic
1104812659 12:131627857-131627879 TTGGAGTAGAAAGGATGCTGTGG - Intergenic
1107174625 13:37386114-37386136 GTGGAGTGGAAAGGAACCACAGG - Intergenic
1108925645 13:55740225-55740247 CTGGAGAATAAAGGATACATAGG - Intergenic
1109692970 13:65917459-65917481 GGGGAGTAGAAAGGAAAAAAAGG + Intergenic
1110235095 13:73209516-73209538 GTGCACTAAAAAGGAAACACAGG - Intergenic
1110254308 13:73415504-73415526 GTGGGGTAGACAGGAGACAGAGG - Intergenic
1111009772 13:82296184-82296206 GTGGAGGAGGAAAGATACAAGGG - Intergenic
1111550448 13:89803597-89803619 GTGGAATAGAAAAGTTACATTGG - Intergenic
1114390877 14:22307237-22307259 GTAGAGTAGAAAGGACACTATGG - Intergenic
1115398457 14:32934425-32934447 GTGGCGGAGGAAGGATGCACCGG - Intergenic
1118032981 14:61836546-61836568 GTGGAGTAGAAAGGAAAATGAGG - Intergenic
1120160049 14:81136296-81136318 TTGGACTAGAAAGCTTACACTGG + Intronic
1126182617 15:45800601-45800623 GTGGGGTAGAAAGGCTATAGGGG - Intergenic
1128138184 15:65279560-65279582 GTGGAGGAGAAAAAGTACACAGG - Intronic
1128606377 15:69039396-69039418 GTGGAGTAGCAAGGAAAGAAGGG + Intronic
1130952822 15:88605683-88605705 GCCGAGTGGAAAGGCTACACTGG - Intergenic
1133854129 16:9533834-9533856 GTGAAGTAGTAAAGAGACACAGG + Intergenic
1138896770 16:61215289-61215311 GTGGAAAAGAAAGGATAGAATGG - Intergenic
1142769357 17:2085528-2085550 GTGGAGTAGGATGGAGGCACCGG + Intronic
1144711641 17:17405187-17405209 GTGGAGTCCCAAGGCTACACAGG - Intergenic
1147602214 17:41753797-41753819 GTGGAGTAGAAAGAAGGCACTGG + Intergenic
1149002300 17:51770002-51770024 CTGGTGTAGAAAGGCTAGACAGG + Intronic
1151637433 17:75360636-75360658 GTGGGGCAAAAAGGACACACAGG + Intronic
1152511598 17:80793501-80793523 GCGGAGGAGAAAGGATACTGCGG - Intronic
1156388105 18:36625141-36625163 ATGGAGCAGAAAAGAGACACGGG + Intronic
1158695332 18:59697961-59697983 GAGGAGTTGAAAGGCTACAACGG + Intergenic
1162797817 19:13095647-13095669 GTGGAGCAGAAAGGGGACCCCGG + Exonic
1163329938 19:16629547-16629569 TTGGAGGAGAAAAGAAACACGGG + Intronic
925456985 2:4024361-4024383 GTGGAGAAGACAGGAGACAGAGG + Intergenic
931797236 2:65722960-65722982 GGAGAGAAGAAAGGATATACAGG + Intergenic
932389944 2:71378868-71378890 GAGGAGTAGAAAGGATGCTTGGG + Intronic
932632342 2:73355785-73355807 GTAGAAAAGAAAGAATACACAGG - Intergenic
935640437 2:105284931-105284953 GTGGAGTAAACAAGATAAACTGG - Intronic
935785124 2:106541834-106541856 GTGGAGTTGGAAGGATAGAAGGG - Intergenic
935922037 2:108026242-108026264 TTGCAGTAAAAAGGAAACACAGG - Intergenic
936765124 2:115837933-115837955 CTGGAACAGAAAGGGTACACAGG + Intronic
937901416 2:127022313-127022335 TTGGAGTTGAAAGGAAATACAGG - Intergenic
939337838 2:140853784-140853806 GTGCAGTAGAAAGGAATCTCTGG - Intronic
942300838 2:174560683-174560705 GTAGAGGAGAGAGGAAACACAGG + Exonic
943109975 2:183592610-183592632 GCGGGGTAGGAGGGATACACTGG + Intergenic
944811437 2:203330335-203330357 GTGGGGTAGAAAAGATTCAGAGG + Intronic
944954419 2:204791424-204791446 GTGCAGTAGTAAGGAAACATTGG + Intronic
945420735 2:209633060-209633082 ATCGAGTAGAAAGGAAAGACTGG - Intronic
948562541 2:238864222-238864244 GTGGAGAAGAGAGGATACCACGG - Intronic
1174329352 20:49805692-49805714 GTGGAGGAGGAAGAATCCACAGG - Intergenic
1174346934 20:49936893-49936915 GTGGACTAGAAAGGAAACGTCGG - Intronic
1176545924 21:8199087-8199109 GTGCAGTTGAAAGAATAAACAGG - Intergenic
1176564875 21:8382132-8382154 GTGCAGTTGAAAGAATAAACAGG - Intergenic
1179068298 21:38047455-38047477 GTTGAGTAGATGGGAGACACAGG - Intronic
1179092019 21:38275098-38275120 GTGAAGTAGAAAGGTTGAACAGG - Intronic
1179510505 21:41869931-41869953 GTGGACTAGAAGGGAGACCCAGG - Intronic
1181324202 22:22032361-22032383 GTGGAGGAGACAGGATACATGGG + Intergenic
1203250796 22_KI270733v1_random:115324-115346 GTGCAGTTGAAAGAATAAACAGG - Intergenic
1203308586 22_KI270736v1_random:126685-126707 GTGGAGTGGAAAGAATGGACTGG + Intergenic
950824089 3:15797600-15797622 GTGGAGATCAAAGGAAACACTGG - Intronic
952216421 3:31282615-31282637 GTGGGGAAGAAAGAATACACAGG + Intergenic
954459966 3:50620737-50620759 ATGGAGTAGAATGGCTGCACTGG - Intronic
956725933 3:72156504-72156526 GGGGAGTAGAAAGGAAACTGGGG + Intergenic
958931866 3:100215992-100216014 GTGGATTAAAAAGGACACAAAGG - Intergenic
959168731 3:102817077-102817099 GGGGAGAAGGAAGGATAAACAGG - Intergenic
960648304 3:119915303-119915325 GTGAAGTTAAAAAGATACACAGG + Intronic
960844699 3:121994913-121994935 GAAGAGTAGAAAGGACTCACTGG - Intronic
965836191 3:172855726-172855748 ATGGAGTAGAGAGGATAGATTGG + Intergenic
966827082 3:183973952-183973974 GGGGAGTAGGAAGGAAACATGGG - Intronic
967374144 3:188781939-188781961 GTGAAGTAGAAGGGACACAGTGG - Intronic
968017972 3:195356593-195356615 GAGGAGAGGAAAGGATAAACAGG + Intronic
969082128 4:4627072-4627094 TTGGAGGAGAAAGGAGACTCAGG - Intergenic
972714065 4:41628272-41628294 ATGGAGGAGAAAGGAAACAAGGG - Intronic
974866763 4:67590625-67590647 GTGAATTAGAAAGAATAAACAGG - Intronic
979784539 4:124699166-124699188 CTGAATTAGAAAGGATACCCAGG + Intronic
980116697 4:128686254-128686276 GTAGATAAGAAAGGCTACACAGG - Intergenic
982531093 4:156544987-156545009 GGGGATTAGGAAGGAAACACAGG - Intergenic
983052507 4:163065232-163065254 GTGAAAGAGCAAGGATACACTGG - Intergenic
985214282 4:187633844-187633866 GTGGAAGAGAAAGAATACATAGG + Intergenic
985256525 4:188075746-188075768 GTAGACTAGAATGGATATACAGG - Intergenic
986271370 5:6233728-6233750 ATGGATTAAAAAGAATACACTGG + Intergenic
986835994 5:11638168-11638190 GTGGAGAAGAGAGGTAACACAGG - Intronic
990274959 5:54185391-54185413 GTGAAATAGAAAAGATACTCAGG - Intronic
991074472 5:62519506-62519528 GTGGAATAGGAAGGACACAGGGG - Intronic
991973068 5:72159488-72159510 GTGGACTAGCAAGTAAACACTGG + Intronic
992146052 5:73849744-73849766 GTGGCTTAGAGAGGATACAAGGG - Intronic
993162368 5:84309172-84309194 GTGGAGAAGAGAGGATAAATGGG - Intronic
996106674 5:119512817-119512839 CTGGAGGAGAAAGGAGACAAGGG + Intronic
998092054 5:139377149-139377171 GTGGAGAGGAAAGGATTCACAGG + Intronic
1000971369 5:167718291-167718313 GTGGTGTAGAAAGGATGTGCTGG + Intronic
1002761800 6:208290-208312 GTAGAGTAGAAATGATGCTCTGG + Intergenic
1003625203 6:7735073-7735095 GTGGAGTGGAGTGGATTCACAGG + Intronic
1004512797 6:16296447-16296469 CTGGAGTAGAGAAGATCCACAGG + Intergenic
1005163188 6:22889367-22889389 GTTGTGTGGAAAGGATACAGTGG + Intergenic
1005169861 6:22970641-22970663 TTGAAATAGAAAGGATATACTGG + Intergenic
1005175756 6:23042598-23042620 TTGTGGTAGAAAGGATAAACTGG + Intergenic
1005351676 6:24941887-24941909 GGGGTGGAGAAAAGATACACAGG + Intronic
1005423480 6:25677008-25677030 GTGGAGGAGAGAAGATAGACAGG - Intronic
1006056448 6:31388471-31388493 GTGGAGTAGAGTGTATTCACAGG - Intergenic
1006069168 6:31485423-31485445 GTGGAGTAGAGTGTATTCACAGG - Intergenic
1011442575 6:87402159-87402181 GTGGAGAAGGAAAGATAAACTGG + Intergenic
1013288418 6:108699608-108699630 GAGGAGAAGAAAGGATTCAGAGG - Intergenic
1014117389 6:117680958-117680980 GTTGAAAAGATAGGATACACTGG - Intronic
1014340408 6:120198453-120198475 CTGGAGAACAAAGGATAAACAGG - Intergenic
1015196035 6:130525569-130525591 GTGGAGTAGGAAGGAAAGAGGGG + Intergenic
1019232642 6:170581198-170581220 GTGGCAGAGAAAGGAAACACTGG - Intronic
1021240317 7:18192492-18192514 GTGGAGTGGAAAGGAATCATGGG + Intronic
1021592022 7:22273905-22273927 GAGGAGTAGATAGTATCCACAGG + Intronic
1023196411 7:37644239-37644261 GTGGAGGAAAAATGAAACACTGG + Intergenic
1023814687 7:43940641-43940663 GAGGACGAGAAAGGATATACAGG - Intronic
1024093613 7:45967580-45967602 GTGGATTAGAAGGGATCCCCTGG + Intergenic
1027853765 7:83482889-83482911 GGGGAGTTGTAAGGATACAGAGG + Intronic
1031375798 7:121024360-121024382 TTGGAGTAAAAACGAGACACTGG - Intronic
1036619627 8:10415975-10415997 TTGGAGGAGAGAGGACACACGGG - Intronic
1038111272 8:24501499-24501521 GTGGAGAACAAAGGATACTTTGG + Exonic
1038457657 8:27688233-27688255 GTAGAGTACAAACCATACACAGG - Intergenic
1038693657 8:29785592-29785614 GAGGACTAGAAAAGATACATTGG - Intergenic
1039344328 8:36687352-36687374 ATGGAGGAGAAAGGACACACAGG + Intergenic
1040551190 8:48438906-48438928 GTTGGGTAGAAAGGATAAATTGG + Intergenic
1040568501 8:48587971-48587993 GAGCAGTAGAGATGATACACCGG - Intergenic
1041298174 8:56383341-56383363 GTAGAATAGAAAGCAGACACTGG + Intergenic
1045146447 8:99349872-99349894 GTGGAGTGGCAAAGATACAGTGG + Intronic
1047487632 8:125346198-125346220 CTGGAATAGAAAGAATAGACTGG + Intronic
1048622364 8:136147857-136147879 ATTCAGTAGGAAGGATACACGGG - Intergenic
1048656679 8:136545471-136545493 GTAGAGTACAAAGGGTACAAAGG + Intergenic
1051349210 9:16183249-16183271 CTGAAGTAGAAAGGATATCCTGG + Intergenic
1051922926 9:22288710-22288732 TTTGAGTAGAAAGGAAACACAGG - Intergenic
1052394824 9:27926398-27926420 GAGAAGTAGTAAGGACACACAGG + Intergenic
1053152282 9:35750668-35750690 GTGGAGTAGAAAGGATACACTGG - Exonic
1054805493 9:69392922-69392944 GTTGAGTAGAGAGGTTACATAGG + Intergenic
1056543158 9:87591922-87591944 CTGGAGTAGAAAGTCTAAACAGG + Intronic
1058919124 9:109596632-109596654 GTGGAGGAGAAGGGATGGACTGG + Intergenic
1061030667 9:128080402-128080424 GTAGAGTAGATAGGACACAGTGG + Intronic
1061998785 9:134205335-134205357 GTGGGGCAGAAAGGAATCACTGG - Intergenic
1203467197 Un_GL000220v1:98588-98610 GTGCAGTTGAAAGAATAAACAGG - Intergenic
1188231921 X:27674682-27674704 GTGGAGTAGAAATGTTAGGCAGG + Intronic
1188755529 X:33956588-33956610 GTGGATAAGAAAGGCTACACAGG - Intergenic
1191779295 X:64848924-64848946 GAGGAGTAGAAGGGGTAGACAGG - Intergenic
1193241172 X:79171450-79171472 GAGGAGTGGAAAGAGTACACAGG - Exonic
1193301430 X:79892811-79892833 TTGGAGGAGAGAGGATACTCTGG - Intergenic
1194973773 X:100372759-100372781 GTGTAGAAGAAAGGAGACTCTGG + Intronic
1195056172 X:101147130-101147152 GTGCAGCAGAAAGGATAAACAGG - Intronic
1195735059 X:108004017-108004039 GTGTATTTGAAAGGATAAACAGG + Intergenic
1196764933 X:119235217-119235239 GAGGAGAAGAAAGGATAGAGAGG - Intergenic
1198090280 X:133322103-133322125 GTGGACTGGCCAGGATACACGGG - Intronic
1198995314 X:142567294-142567316 GGGGAGTAGTAAAGATAAACTGG - Intergenic
1200106405 X:153715695-153715717 GTGGAGCAGAGAGGAGACACGGG + Intronic
1202609910 Y:26670026-26670048 ATGGAGTAGAATGGAATCACAGG + Intergenic