ID: 1053155729

View in Genome Browser
Species Human (GRCh38)
Location 9:35777423-35777445
Sequence CAGGCCTAAATCATGTTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053155718_1053155729 26 Left 1053155718 9:35777374-35777396 CCTCCTCAGCCTCCCAAAGTGCT 0: 60215
1: 147830
2: 155736
3: 113395
4: 79914
Right 1053155729 9:35777423-35777445 CAGGCCTAAATCATGTTTTGTGG No data
1053155722_1053155729 17 Left 1053155722 9:35777383-35777405 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1053155729 9:35777423-35777445 CAGGCCTAAATCATGTTTTGTGG No data
1053155717_1053155729 27 Left 1053155717 9:35777373-35777395 CCCTCCTCAGCCTCCCAAAGTGC 0: 2778
1: 98844
2: 221886
3: 241963
4: 257850
Right 1053155729 9:35777423-35777445 CAGGCCTAAATCATGTTTTGTGG No data
1053155716_1053155729 30 Left 1053155716 9:35777370-35777392 CCACCCTCCTCAGCCTCCCAAAG 0: 1790
1: 49413
2: 144311
3: 183086
4: 167723
Right 1053155729 9:35777423-35777445 CAGGCCTAAATCATGTTTTGTGG No data
1053155724_1053155729 14 Left 1053155724 9:35777386-35777408 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1053155729 9:35777423-35777445 CAGGCCTAAATCATGTTTTGTGG No data
1053155720_1053155729 23 Left 1053155720 9:35777377-35777399 CCTCAGCCTCCCAAAGTGCTGGG 0: 84188
1: 205795
2: 234195
3: 260821
4: 298692
Right 1053155729 9:35777423-35777445 CAGGCCTAAATCATGTTTTGTGG No data
1053155725_1053155729 13 Left 1053155725 9:35777387-35777409 CCAAAGTGCTGGGATTACAGGCG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
Right 1053155729 9:35777423-35777445 CAGGCCTAAATCATGTTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053155729 Original CRISPR CAGGCCTAAATCATGTTTTG TGG Intergenic
No off target data available for this crispr