ID: 1053159633

View in Genome Browser
Species Human (GRCh38)
Location 9:35805122-35805144
Sequence TGTCTTCCTAATTAGTAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053159631_1053159633 9 Left 1053159631 9:35805090-35805112 CCAGCTACTCTTGATACCTGGGT 0: 1
1: 0
2: 0
3: 9
4: 124
Right 1053159633 9:35805122-35805144 TGTCTTCCTAATTAGTAGCCAGG No data
1053159632_1053159633 -7 Left 1053159632 9:35805106-35805128 CCTGGGTCTCAAGTCATGTCTTC 0: 1
1: 0
2: 0
3: 18
4: 181
Right 1053159633 9:35805122-35805144 TGTCTTCCTAATTAGTAGCCAGG No data
1053159628_1053159633 20 Left 1053159628 9:35805079-35805101 CCTTGGTATATCCAGCTACTCTT 0: 1
1: 1
2: 2
3: 12
4: 127
Right 1053159633 9:35805122-35805144 TGTCTTCCTAATTAGTAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053159633 Original CRISPR TGTCTTCCTAATTAGTAGCC AGG Intronic
No off target data available for this crispr