ID: 1053160262

View in Genome Browser
Species Human (GRCh38)
Location 9:35809192-35809214
Sequence GAAGCATCCTAGCTCATCTA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 68}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053160262_1053160264 -8 Left 1053160262 9:35809192-35809214 CCCTAGATGAGCTAGGATGCTTC 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1053160264 9:35809207-35809229 GATGCTTCCAGCTAGAGCTTCGG 0: 1
1: 0
2: 0
3: 9
4: 126
1053160262_1053160271 11 Left 1053160262 9:35809192-35809214 CCCTAGATGAGCTAGGATGCTTC 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1053160271 9:35809226-35809248 TCGGGGGGATGTGGAAATGAAGG 0: 1
1: 0
2: 1
3: 17
4: 204
1053160262_1053160270 2 Left 1053160262 9:35809192-35809214 CCCTAGATGAGCTAGGATGCTTC 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1053160270 9:35809217-35809239 GCTAGAGCTTCGGGGGGATGTGG 0: 1
1: 0
2: 1
3: 9
4: 196
1053160262_1053160266 -6 Left 1053160262 9:35809192-35809214 CCCTAGATGAGCTAGGATGCTTC 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1053160266 9:35809209-35809231 TGCTTCCAGCTAGAGCTTCGGGG 0: 1
1: 0
2: 1
3: 4
4: 92
1053160262_1053160273 21 Left 1053160262 9:35809192-35809214 CCCTAGATGAGCTAGGATGCTTC 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1053160273 9:35809236-35809258 GTGGAAATGAAGGTGATGGCAGG 0: 1
1: 1
2: 3
3: 58
4: 457
1053160262_1053160267 -5 Left 1053160262 9:35809192-35809214 CCCTAGATGAGCTAGGATGCTTC 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1053160267 9:35809210-35809232 GCTTCCAGCTAGAGCTTCGGGGG 0: 1
1: 0
2: 1
3: 7
4: 77
1053160262_1053160275 28 Left 1053160262 9:35809192-35809214 CCCTAGATGAGCTAGGATGCTTC 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1053160275 9:35809243-35809265 TGAAGGTGATGGCAGGCCATGGG 0: 1
1: 0
2: 0
3: 18
4: 231
1053160262_1053160276 29 Left 1053160262 9:35809192-35809214 CCCTAGATGAGCTAGGATGCTTC 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1053160276 9:35809244-35809266 GAAGGTGATGGCAGGCCATGGGG 0: 1
1: 0
2: 0
3: 25
4: 304
1053160262_1053160274 27 Left 1053160262 9:35809192-35809214 CCCTAGATGAGCTAGGATGCTTC 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1053160274 9:35809242-35809264 ATGAAGGTGATGGCAGGCCATGG 0: 1
1: 0
2: 1
3: 27
4: 368
1053160262_1053160265 -7 Left 1053160262 9:35809192-35809214 CCCTAGATGAGCTAGGATGCTTC 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1053160265 9:35809208-35809230 ATGCTTCCAGCTAGAGCTTCGGG 0: 1
1: 0
2: 1
3: 10
4: 244
1053160262_1053160268 -4 Left 1053160262 9:35809192-35809214 CCCTAGATGAGCTAGGATGCTTC 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1053160268 9:35809211-35809233 CTTCCAGCTAGAGCTTCGGGGGG 0: 1
1: 0
2: 0
3: 3
4: 88
1053160262_1053160272 17 Left 1053160262 9:35809192-35809214 CCCTAGATGAGCTAGGATGCTTC 0: 1
1: 0
2: 0
3: 6
4: 68
Right 1053160272 9:35809232-35809254 GGATGTGGAAATGAAGGTGATGG 0: 1
1: 2
2: 11
3: 59
4: 651

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053160262 Original CRISPR GAAGCATCCTAGCTCATCTA GGG (reversed) Exonic
905119233 1:35668995-35669017 GAAGAATCCCAGGTCATCTGTGG + Intergenic
911818403 1:102384658-102384680 GAAGCAGGCAAGCTAATCTATGG + Intergenic
914346727 1:146806439-146806461 GGAGCAGACCAGCTCATCTAAGG + Intergenic
917731663 1:177880945-177880967 AAAGCATCCTAGCAGAACTAGGG - Intergenic
920239846 1:204538521-204538543 GTAGCATGCTAGCTCATGGAAGG - Intronic
920957774 1:210634875-210634897 GAAGCATCTCAGCTTATCTGAGG + Intronic
921246377 1:213246197-213246219 GAATCATCCTAGATAATCTAAGG - Intronic
1069327984 10:67254450-67254472 GAAGGATCATAACTCATCCAAGG + Intronic
1069543955 10:69316053-69316075 CAAGCATCCCCTCTCATCTAAGG - Intronic
1076165576 10:128279771-128279793 GAGGCATCCTCCTTCATCTAAGG - Intergenic
1080315492 11:30943149-30943171 GGAGCACCACAGCTCATCTAGGG - Intronic
1088138016 11:106580670-106580692 CAAGCATCATAGCTGATCTCAGG - Intergenic
1090912574 11:131134295-131134317 GATTCATCCTAGATCATCCATGG - Intergenic
1091912648 12:4244394-4244416 GAAGCTTCCTATCACCTCTACGG - Intergenic
1095148709 12:38764037-38764059 GCAGTATCCTCACTCATCTAAGG + Intronic
1097957866 12:65505206-65505228 GAAGCAACCTAGTTTATCAATGG - Intergenic
1097975026 12:65676263-65676285 GTAGCATCCTAGTTCCTCTCTGG - Intergenic
1100166362 12:91922404-91922426 GGAGCATCTTAGCTCAGCTCAGG + Intergenic
1105599133 13:21870124-21870146 GCAGACTCCTAGCTCATCTATGG + Intergenic
1108069525 13:46613927-46613949 AAAGCAACCTGGCTCACCTAAGG - Intronic
1109119937 13:58442211-58442233 GAAGTATAGTAACTCATCTAGGG - Intergenic
1110389708 13:74959737-74959759 CAAGCATCCTAGGTCAACTTCGG - Intergenic
1116663879 14:47749683-47749705 GAAGCACTCAAGGTCATCTATGG - Intergenic
1118130764 14:62960810-62960832 GAAGGATGCTAGCTAATCCATGG - Intronic
1118459416 14:65975044-65975066 GAAACAGCCTAGCTCATGTTCGG - Intronic
1119041573 14:71279207-71279229 AAAGCATCCTAGCTCCTAAAAGG - Intergenic
1120603814 14:86546420-86546442 AAAGCAACCTATCTCATCGAAGG - Intergenic
1122737289 14:103850053-103850075 GATGCATCCTAGCATATGTAAGG + Intergenic
1124213227 15:27781217-27781239 GAAACATCCTATCTCTTCTTGGG + Intronic
1126731453 15:51687427-51687449 GAAGCATTGTAGCACATCCATGG - Intronic
1131046394 15:89319158-89319180 AAAGCATCCAAGCTCTTCTGGGG + Intronic
1139850541 16:69949505-69949527 GGAGCATCCCAGCTAATCCAAGG - Intergenic
1139879525 16:70172417-70172439 GGAGCATCCCAGCTAATCCAAGG - Intergenic
1139987254 16:70908831-70908853 GGAGCAGACCAGCTCATCTAAGG - Exonic
1140280035 16:73545474-73545496 GAAGCATCCTCCTTCAGCTAAGG - Intergenic
1140372999 16:74423131-74423153 GGAGCATCCCAGCTAATCCAAGG + Intergenic
1141480940 16:84306498-84306520 AAAGCATCCTTCCTCATCTCTGG + Intronic
1144305696 17:13967444-13967466 GAACAATCCCATCTCATCTAGGG - Intergenic
1148692016 17:49534217-49534239 GGAGAATCAGAGCTCATCTATGG + Intergenic
1152060476 17:78070465-78070487 GAAGCCTCCTGGCTCTTCTGTGG + Intronic
1156985874 18:43351032-43351054 GAAGCAGCCTCGTTCATCTGGGG + Intergenic
1159299983 18:66550770-66550792 GTAGGATCCTAGTTCATTTAAGG - Intronic
1167854085 19:52224344-52224366 GAGGCATCCACTCTCATCTATGG - Intronic
925487999 2:4357743-4357765 GGGGCATCCTCGCTCATCTAGGG - Intergenic
930389305 2:50740339-50740361 CCAGCATCCTAGTTTATCTAAGG + Intronic
935197160 2:100823956-100823978 GTAGCCTCCCAGCTCAGCTATGG + Intronic
938128403 2:128690793-128690815 AAAGCGTCCTAGCTCCTCTATGG + Intergenic
940514810 2:154669443-154669465 GACTCATCCTATCTCAACTATGG - Intergenic
1179068040 21:38044624-38044646 GTAGCATCCTATCTCAGCTGAGG - Intronic
954041766 3:47893328-47893350 GGAGCAACCCAGCTCATCCAAGG - Intronic
954943245 3:54393986-54394008 GAAGCATCCTAGACCCTGTATGG - Intronic
973179308 4:47248719-47248741 GAACCATCCTAGCTCAAATCAGG - Intronic
974698404 4:65405329-65405351 GAAGCATGCTAGATATTCTATGG - Intronic
975232831 4:71954819-71954841 GGAGCCTGATAGCTCATCTATGG - Intergenic
979206112 4:118040353-118040375 GAAGTATATGAGCTCATCTAAGG + Intronic
983990206 4:174108780-174108802 GAAGCATTTTAGCTCATGTATGG - Intergenic
989131609 5:38112643-38112665 GAAGTTTCCTATCTCTTCTATGG + Intergenic
991697728 5:69288635-69288657 GAGGCATCCTAGCAAATCAATGG + Intronic
998524070 5:142826560-142826582 GAAGAATCCTAACTCCCCTACGG - Intronic
1003108275 6:3231698-3231720 GTAGCATCCTGGCTTTTCTAGGG + Intronic
1013194368 6:107832458-107832480 GAAGCTTCCTTGCTCCTCTGTGG - Intergenic
1018693172 6:166365995-166366017 GAAGTAGCCCAGCTCATCCAGGG - Exonic
1022277004 7:28865073-28865095 GAAGCCTCCTAGCAGATCTGTGG - Intergenic
1022668385 7:32432019-32432041 GATGCATCCTTGCTTATCTATGG + Intergenic
1027698611 7:81440946-81440968 GAAGCATCCTAGATGACCTTCGG + Intergenic
1030913285 7:115279787-115279809 TAAGCATCATAGATCAACTAGGG + Intergenic
1040405886 8:47101553-47101575 AAAGCATTCTAGCTAGTCTACGG + Intergenic
1052607166 9:30719790-30719812 GAAGCATCCAAGGTCTTCTCTGG - Intergenic
1053160262 9:35809192-35809214 GAAGCATCCTAGCTCATCTAGGG - Exonic
1058266981 9:102913070-102913092 GAAACATCCTTGCATATCTAGGG - Intergenic
1059564262 9:115367220-115367242 ACAGCGTCCTACCTCATCTATGG + Intronic
1187005035 X:15224445-15224467 GTAGCATCCCAGCTCTTTTAAGG - Intergenic
1188844631 X:35058229-35058251 GAGGCATCCTAGCCCCTTTAAGG + Intergenic
1195049244 X:101081609-101081631 TAATCATCCCAGCTGATCTAGGG - Intronic
1195510239 X:105707455-105707477 GCAGCATGCTAGTTCCTCTAAGG + Intronic