ID: 1053161100

View in Genome Browser
Species Human (GRCh38)
Location 9:35813925-35813947
Sequence AGGGTAGGGCCAGAAGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 318}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053161089_1053161100 22 Left 1053161089 9:35813880-35813902 CCCACCCAGGAGGAAAGTTCCTG 0: 1
1: 0
2: 2
3: 20
4: 167
Right 1053161100 9:35813925-35813947 AGGGTAGGGCCAGAAGGTGCTGG 0: 1
1: 0
2: 1
3: 27
4: 318
1053161092_1053161100 17 Left 1053161092 9:35813885-35813907 CCAGGAGGAAAGTTCCTGAATTT 0: 1
1: 0
2: 1
3: 15
4: 174
Right 1053161100 9:35813925-35813947 AGGGTAGGGCCAGAAGGTGCTGG 0: 1
1: 0
2: 1
3: 27
4: 318
1053161091_1053161100 18 Left 1053161091 9:35813884-35813906 CCCAGGAGGAAAGTTCCTGAATT 0: 1
1: 0
2: 1
3: 19
4: 225
Right 1053161100 9:35813925-35813947 AGGGTAGGGCCAGAAGGTGCTGG 0: 1
1: 0
2: 1
3: 27
4: 318
1053161090_1053161100 21 Left 1053161090 9:35813881-35813903 CCACCCAGGAGGAAAGTTCCTGA 0: 1
1: 0
2: 1
3: 19
4: 165
Right 1053161100 9:35813925-35813947 AGGGTAGGGCCAGAAGGTGCTGG 0: 1
1: 0
2: 1
3: 27
4: 318
1053161093_1053161100 3 Left 1053161093 9:35813899-35813921 CCTGAATTTCAGAGCACCAGCAG 0: 1
1: 0
2: 1
3: 21
4: 177
Right 1053161100 9:35813925-35813947 AGGGTAGGGCCAGAAGGTGCTGG 0: 1
1: 0
2: 1
3: 27
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053161100 Original CRISPR AGGGTAGGGCCAGAAGGTGC TGG Intronic
900674533 1:3876755-3876777 AGGGTGGGAAGAGAAGGTGCAGG - Intronic
901645471 1:10714822-10714844 AGGGAAGGGGCAGAGGGTGGAGG - Intronic
901778450 1:11576637-11576659 AGGCTTGGGCCAGCAGGTGCTGG - Intergenic
901881823 1:12198626-12198648 AGGGCTGGGCCAGGAGGGGCCGG + Intronic
902300915 1:15502213-15502235 AGGGGAGGGACAGAGGCTGCAGG + Intronic
902642384 1:17775165-17775187 AGGCTGAGGCCAGATGGTGCAGG + Intronic
902824903 1:18966192-18966214 TGGGTAGGGCTGGAAAGTGCTGG - Intergenic
903211026 1:21818812-21818834 GGGGCAGGGCCAGATCGTGCAGG - Intronic
903443014 1:23402390-23402412 TGGGTAGGGGCAGGACGTGCAGG - Intronic
904377710 1:30092196-30092218 AGGGAAGGGCAAGAAGGTGTGGG - Intergenic
905246332 1:36616860-36616882 AGGGAAGGAGCAGAATGTGCTGG + Intergenic
905401778 1:37708842-37708864 AGGGTAGGTCCAGAAGGTGGGGG + Exonic
905447041 1:38034286-38034308 AGGACAGGGCCTGAAGGGGCTGG + Intergenic
906053950 1:42899881-42899903 AGGGAAGGACCACCAGGTGCGGG + Intergenic
906057659 1:42929345-42929367 AGGGAAGGGCCACAATGTCCAGG - Intronic
906318721 1:44803934-44803956 GGGGCTGGGCCAGAAGCTGCTGG - Exonic
908800549 1:67875645-67875667 AAAGCAGGGCCAGAAGATGCGGG + Intergenic
909931634 1:81504575-81504597 AGGGAAGGGCCAGAGGGGCCGGG - Intronic
911117751 1:94264352-94264374 AGTCTTGGGACAGAAGGTGCAGG - Intronic
912455896 1:109797079-109797101 AGGATAGGGCAAGAATGTTCTGG - Intergenic
915496576 1:156286218-156286240 AGGGTAGGGTCAGAAAAGGCAGG - Intronic
915571693 1:156748437-156748459 AGGGTGGGGCCAAATAGTGCTGG + Intronic
915596890 1:156901184-156901206 AGGGTAGGGCCAGAGTGCGGAGG - Intronic
916493075 1:165318697-165318719 AGTGTAGGGCCAAAAGGTGAAGG - Intronic
917243252 1:172972300-172972322 AGGTTGGGGCCAGAATGTGTGGG + Intergenic
919751365 1:201040138-201040160 AGGGTAGGGCCAACAGAGGCAGG - Intronic
919906927 1:202084896-202084918 TGGGGAGGGCCACAAGGTGGAGG + Intergenic
920388821 1:205586256-205586278 GGGGTAGGGCCAGGAGGAGGCGG - Intronic
921386195 1:214572387-214572409 GGGGAAGGGTCAGAAGGTTCAGG + Intergenic
921757236 1:218872890-218872912 AGGCTGGGGCCAGAGTGTGCAGG + Intergenic
922807601 1:228398732-228398754 AGGGCAGGGGCAGATGGTGCTGG + Intronic
923545252 1:234918957-234918979 AGGGAAAGGCCAGAAGCTGGAGG - Intergenic
1063213000 10:3898451-3898473 AGGGTGGGGACAGATTGTGCAGG - Intergenic
1063494889 10:6498046-6498068 AGGGTTGGGCCATTAGGTGGGGG + Intronic
1065058505 10:21872703-21872725 ATGGAAGTGCCAGAAGGTGGTGG + Intronic
1065490036 10:26273499-26273521 AGGTTAGTGCCAGAAGGAGGTGG + Intronic
1065787058 10:29226111-29226133 TAGGTTGGGCCAGAAGGTGAGGG - Intergenic
1066145500 10:32553925-32553947 AGGGAAGGACCATAAGGTGGGGG + Intronic
1067456884 10:46425502-46425524 AGGGTAGGGGGAGAACGTGGGGG - Intergenic
1067680595 10:48435718-48435740 AGGGTGGGGACATAAGGTGGTGG - Exonic
1067897887 10:50204341-50204363 AGGGAAGTGACAGAAGGTGTTGG + Intronic
1068734674 10:60399427-60399449 AGGGAAGGGCCAGATGGTTTTGG + Intronic
1069511289 10:69044410-69044432 ATGGTAGGGGCAGAAAGTGAAGG - Intergenic
1073180235 10:101579073-101579095 TGGGTGGGGACAGAAGCTGCAGG - Exonic
1073446022 10:103580773-103580795 AGGGGAGGGACAAAAGCTGCTGG - Intronic
1074300871 10:112232350-112232372 AGGGCAGGGGCAGAAGGGGCTGG + Intergenic
1074401841 10:113147895-113147917 AGGTTAGGGCCTCAAGGTGCGGG + Intronic
1074519759 10:114208451-114208473 AGGCTAGGTCAAGAAGGGGCAGG - Intronic
1074688135 10:115978413-115978435 TGGGCAGGGCCAGAAGTTGGGGG + Intergenic
1075419101 10:122287712-122287734 AGGGTCTGGCCAGAAGTTCCAGG - Intronic
1077249297 11:1553988-1554010 AGGGTGGGGGCAGAGGCTGCTGG - Intergenic
1077442826 11:2576691-2576713 GGGGCAAGGCCAGAAGGGGCTGG + Intronic
1077547876 11:3183723-3183745 AGGCAAGGACCAGAAGCTGCAGG - Intergenic
1077630968 11:3810750-3810772 TGGGAAGGGACTGAAGGTGCAGG + Intronic
1081842861 11:46215830-46215852 ATGGTAGGGACAGAAACTGCAGG - Intergenic
1083178642 11:60970500-60970522 AGGGCAGCGGCAGCAGGTGCCGG + Intergenic
1083184485 11:61009209-61009231 CAGGTGGGGCCAGAAGGTTCTGG + Intronic
1083514351 11:63242917-63242939 AGGGCAGAGACAGAAGGTGGAGG - Intronic
1083663019 11:64260537-64260559 GGGGCAGGGCCAGGGGGTGCAGG + Intronic
1083719619 11:64597942-64597964 AGGGTGCGGCCAGAGGGCGCTGG + Intronic
1083773809 11:64883412-64883434 AAGGCAGGGCCAGAAGCTGCAGG - Intronic
1084521784 11:69667431-69667453 GGTGAAGGGCCAGACGGTGCTGG - Exonic
1085457272 11:76672135-76672157 AGGGGATGGGCAGGAGGTGCAGG + Intergenic
1086685622 11:89730394-89730416 TGGGTAGGACCGGAGGGTGCGGG - Intergenic
1087890222 11:103529652-103529674 AGGGGAGGGATAGATGGTGCTGG - Intergenic
1088464450 11:110119505-110119527 AGGGAAGAGCCAGAAGAAGCAGG - Intronic
1089040723 11:115446864-115446886 AGGGTAGGGGCAGACGATGATGG - Intronic
1091210519 11:133854412-133854434 AGGGAAGGACCATCAGGTGCGGG + Intergenic
1091765567 12:3117938-3117960 AGGGAATGGCCTGAAGGTGGAGG + Intronic
1091809378 12:3382386-3382408 AAGGTAGGGCCAGCAAATGCAGG - Intronic
1092254037 12:6916625-6916647 TGGGTCGGGCCAGGAGGGGCCGG - Intronic
1093720579 12:22437487-22437509 AGGGAAGGACCAGCAGGTGGGGG - Intergenic
1095646748 12:44556937-44556959 AGGTTGGGGCCAGATGGTGAAGG + Intronic
1096504584 12:52084717-52084739 TGGGTAGGGCCAGACTGGGCAGG + Intergenic
1097970724 12:65630184-65630206 AGCGTGGGGCCAGATGCTGCGGG + Intergenic
1100406076 12:94273949-94273971 ATGGCAGGGCCAGGAGGTACTGG - Intronic
1101853639 12:108424315-108424337 GGGGTAGATCCTGAAGGTGCTGG - Intergenic
1103193472 12:119022136-119022158 AGGATACGGGCAGAATGTGCAGG - Intronic
1103328935 12:120140464-120140486 TGGGTAGGGCAGGAGGGTGCGGG - Intronic
1103843655 12:123886344-123886366 AGAGTAGTGCCAGGAGCTGCTGG + Intronic
1103917238 12:124382167-124382189 AGGGGAGGGGCAGGAGGTGGAGG + Intronic
1105543945 13:21338384-21338406 AGGGGAGGGGCAGAAATTGCTGG + Intergenic
1106388953 13:29316673-29316695 TAAGTAGGGCCAGAAGTTGCAGG + Intronic
1106765537 13:32909602-32909624 AGGGGAGGGCTAGAAGATGGGGG + Intergenic
1106923800 13:34591930-34591952 GGGGCAGGGCCAGAAAGTCCAGG - Intergenic
1107394138 13:39997495-39997517 AGATGAGGGGCAGAAGGTGCCGG + Intergenic
1111143016 13:84146561-84146583 AGCCTAGGGCCAGAAGTTTCTGG - Intergenic
1112035356 13:95492268-95492290 AGGGAAGGACCATAAGGTGGGGG + Intronic
1113653162 13:112052273-112052295 AGGGTCGGGCCTCATGGTGCGGG - Intergenic
1113896384 13:113766782-113766804 TGGGAACGGCCAGAAGGTGGTGG + Intronic
1121114683 14:91335385-91335407 AGGTCAGGGCCACAAGGTCCTGG - Intronic
1121915395 14:97833109-97833131 AGGGAGGGGGCAGAAGCTGCTGG + Intergenic
1122123073 14:99564934-99564956 ATGGAAGCTCCAGAAGGTGCGGG + Intronic
1123116903 14:105899011-105899033 AGGACAGGGCCTGCAGGTGCAGG + Intergenic
1123118958 14:105908286-105908308 AGGGGAGGGCCTGCAGGTGTAGG + Intergenic
1123121183 14:105917876-105917898 AGGGGAGGGCCTGCATGTGCAGG + Intergenic
1123403886 15:20009445-20009467 AGGGGAGGGCCTGCATGTGCAGG + Intergenic
1123513226 15:21016091-21016113 AGGGGAGGGCCTGCATGTGCAGG + Intergenic
1124427482 15:29574063-29574085 AAGGTAGGGAGAGAGGGTGCTGG + Intergenic
1124721957 15:32118155-32118177 GGGGAGGGGCCTGAAGGTGCTGG - Intronic
1125500808 15:40239456-40239478 AGGGGAGAGCTAGAAGGGGCGGG - Exonic
1125629003 15:41132324-41132346 AGGGTAGGGACACCAGGGGCAGG - Intergenic
1126675319 15:51155584-51155606 AGGGTAGGGCCGGGAAGAGCAGG + Intergenic
1128760911 15:70215440-70215462 AGGCCAGAGCCAGAAGGGGCAGG - Intergenic
1128892335 15:71342550-71342572 AGGGCAGGGGCAGAAGTTGGGGG - Intronic
1128907596 15:71482035-71482057 AGACTATGGCCAGAAGGAGCAGG - Intronic
1128943552 15:71807236-71807258 AGGGTCTGGGCAGAAGGAGCAGG + Intronic
1129295294 15:74596880-74596902 AGGGAAGGGCCAGAGGGGCCGGG - Exonic
1131520512 15:93110722-93110744 AGGGAAGGGCCAGAGAGTGGGGG - Intergenic
1133024457 16:2981912-2981934 AGGCCAGGGCTAGAAGGAGCAGG - Intergenic
1133115485 16:3576006-3576028 AGGGTAGGGCCCTGAGGTGCAGG - Intronic
1133265365 16:4580178-4580200 CGGGAAGGGCCAGAAGGTCTAGG - Intronic
1133309865 16:4838004-4838026 AAGATGGGGCCAGAAGGTGTGGG + Intronic
1133324293 16:4934138-4934160 AGAGTCAGGCCAGATGGTGCAGG - Intronic
1133882678 16:9797816-9797838 AGGCCAGGGCCAGAAGATGCAGG - Intronic
1134857882 16:17535845-17535867 AGTGTAGGACGAGAGGGTGCAGG - Intergenic
1135846499 16:25923581-25923603 AATGTAGAGCCAGAAGTTGCAGG - Intronic
1136185685 16:28587559-28587581 AGGCCAGGGCCAGAAGATGGAGG - Intronic
1137375666 16:47949808-47949830 AGGAGAGGGCAGGAAGGTGCCGG - Intergenic
1137613171 16:49832580-49832602 AGGGTACAGCCAAAAGATGCAGG + Intronic
1141965632 16:87440894-87440916 AGGGCTGGGCGTGAAGGTGCAGG - Intronic
1142051333 16:87960041-87960063 AGGGTGGGGGTAGGAGGTGCCGG - Intronic
1142204364 16:88775791-88775813 AGGGTAGGGAGAGTATGTGCAGG + Intronic
1142740981 17:1931987-1932009 AGAGTAGGGCCCGGAGGAGCTGG + Intergenic
1142861326 17:2763787-2763809 TGGGTGGGGCCAGGAGGTGAAGG + Intergenic
1143874619 17:9982132-9982154 AGGCTGGGGCCAGAAGGAGATGG + Intronic
1144076922 17:11727921-11727943 AGGTAAGGGCCAGAAGTTGGTGG + Exonic
1147460105 17:40562918-40562940 AGGGAATGGGCATAAGGTGCAGG - Intronic
1148054764 17:44787473-44787495 GGGGAAGAGCCTGAAGGTGCTGG - Intergenic
1148447328 17:47745457-47745479 AGAGAAGGGCCAGAGGGAGCGGG - Exonic
1148455218 17:47807802-47807824 AGGGAAGGGGAAGAAGATGCTGG + Exonic
1148910931 17:50942375-50942397 AGGGTAGGGGCAGATGGCTCTGG - Intergenic
1149221185 17:54416588-54416610 GGGGCAGGGTCACAAGGTGCAGG - Intergenic
1149493195 17:57099816-57099838 AGCCTAGTGACAGAAGGTGCTGG + Intronic
1150538970 17:66076594-66076616 AGGGAAGGCCCAGCAGGTGGGGG - Intronic
1151346904 17:73507865-73507887 AGGGAAGTGACAGAAGATGCTGG - Intronic
1151786348 17:76276893-76276915 AGGGTGGAGCGAGAAGGTGGAGG + Intronic
1151887184 17:76930009-76930031 AGGGGAGGGGAAGATGGTGCCGG + Intronic
1152073984 17:78147553-78147575 AGGATGGGGCAAGAAAGTGCAGG - Intronic
1152127974 17:78458842-78458864 AGGCAGGGGCCAGATGGTGCCGG - Intronic
1152434153 17:80264856-80264878 CAGGAAGGGCCAGAAGGTGGTGG - Intronic
1152467725 17:80475457-80475479 AGGGTCGGGCAAGCAGGTGCAGG + Intronic
1152659577 17:81536004-81536026 AGGGTAGCGCCTGATGGTGGTGG + Intronic
1153658720 18:7307751-7307773 ACCGCAGGGCCAGAAGCTGCTGG + Intergenic
1154216764 18:12421172-12421194 AGGCTGGGGGCAGCAGGTGCAGG - Intronic
1157713603 18:49866873-49866895 GGGGTAGGGCCAGAGGGTAAGGG + Intronic
1157780123 18:50430868-50430890 CAGGCAGGGCCAGAGGGTGCAGG + Intergenic
1157780129 18:50430887-50430909 CAGGCAGGGCCAGAGGGTGCAGG + Intergenic
1158886223 18:61829645-61829667 AGGGGAGGACCAGGAGGTGAGGG + Intronic
1158931880 18:62330742-62330764 TGTGCAGGGGCAGAAGGTGCAGG + Intronic
1160483831 18:79269854-79269876 AAGGCAGGGCCAGCAGGCGCAGG - Intronic
1161280177 19:3441666-3441688 AGGGAAGGGCCAGAGGGGCCGGG + Intronic
1161642042 19:5430336-5430358 AGAGTAAGTCCAGGAGGTGCTGG + Intergenic
1161984805 19:7647325-7647347 AGGGCAGGGGCAGAAAGTCCAGG - Intronic
1162566377 19:11447457-11447479 AAGTCAGGGGCAGAAGGTGCTGG - Exonic
1162758233 19:12873213-12873235 AGGGAAGGGCCAGAAGGGGTGGG + Intronic
1162905106 19:13818482-13818504 AAGGTGGGGCCAGAGGGTGGAGG - Intronic
1164463161 19:28465441-28465463 AGGGCAGGCACAGGAGGTGCTGG + Intergenic
1164474385 19:28563925-28563947 CGGGAAGGGGCAGAAGGAGCTGG - Intergenic
1164528224 19:29027372-29027394 AGAGCAGGGACAGAAGGTGAAGG + Intergenic
1164813010 19:31172955-31172977 AAGATAGGGACAGAAGGTGATGG + Intergenic
1165093183 19:33397086-33397108 AGGGCAGGCCCAGCAGCTGCAGG - Intronic
1165432398 19:35780378-35780400 AGAGAAGGGTCAGAAGGAGCAGG - Intronic
1166360001 19:42249107-42249129 AGGGTAGTGCAGGAAGGCGCGGG + Exonic
1166693670 19:44839786-44839808 AGGGCAGGGCAAGGAGGGGCTGG - Intergenic
1166823526 19:45595393-45595415 AGGGGAGAGCCAGGAGCTGCTGG + Intronic
1166907600 19:46123999-46124021 AAAGCAGGGCCAGAAGGTGCAGG + Exonic
1166911393 19:46160746-46160768 AAAGCAGGGCCAGAAGGTGCAGG - Exonic
1167385471 19:49160633-49160655 AGGGCAGGGCCAGAGCTTGCAGG + Intronic
1167859849 19:52273792-52273814 AGAGCAGAGCCAGAAGGTGGGGG + Intronic
1167994287 19:53390166-53390188 TGGGCGGGGCCAGAAGGTGGAGG + Intronic
925579327 2:5394689-5394711 AGGGTAGGGATAGTAGGTGATGG + Intergenic
925599193 2:5590770-5590792 AGGGCAGAGCCACAGGGTGCGGG - Intergenic
925726562 2:6878197-6878219 GGGGTAAGGCGAGAAGGGGCTGG + Intronic
925899745 2:8500277-8500299 AGGGCTGGGACAGAGGGTGCTGG - Intergenic
926196302 2:10765554-10765576 AGGGTGGGGCCAGAAAGCTCGGG + Intronic
927886176 2:26720399-26720421 TGGGATGGGCCAGAAGGAGCTGG + Intronic
928105471 2:28467994-28468016 AGGATAGAGTCAGAAGGTGGAGG + Intronic
929106012 2:38366914-38366936 AGGGTAGGACATGAAGGGGCTGG - Intronic
929758098 2:44784782-44784804 GGGCAAGGGCCAGAATGTGCAGG + Intergenic
929768170 2:44868193-44868215 ATGGTGGGACCAGATGGTGCTGG + Intergenic
931262686 2:60633943-60633965 CCGGTAAGGCCAGAAGATGCAGG + Intergenic
933809749 2:86025931-86025953 AGTGTAGGCCTAGGAGGTGCAGG + Exonic
934531320 2:95091024-95091046 AGGGTAGGGCCAGTGGCTGGAGG - Intronic
934675774 2:96248766-96248788 AGAATGGGGCCTGAAGGTGCAGG - Exonic
934735828 2:96689374-96689396 AAGGTAAGGCCAGAGGGGGCAGG + Intergenic
935256086 2:101310880-101310902 AGTGTAGGGAAAGAAGGTCCTGG - Intergenic
936060340 2:109291452-109291474 ATGGTAGGGCCAGGAGGACCGGG + Intronic
937896212 2:126978419-126978441 AGGGAAGGGAAAGAAGGTGTGGG - Intergenic
937963302 2:127480491-127480513 AGGGTTGGGCCAGCAGGACCCGG - Intronic
938370785 2:130767182-130767204 AGTGTCAGGCCAGCAGGTGCAGG + Exonic
938422381 2:131155392-131155414 AGGGAGGCTCCAGAAGGTGCAGG - Intronic
938711126 2:133977156-133977178 AGGGCAGGGCCAGCAGTTGCAGG - Intergenic
940015776 2:149102536-149102558 AGGGTGGGACCAGAAGATGTAGG + Intronic
942165946 2:173241095-173241117 AGGGGAGGGCAAGAGGATGCTGG + Intronic
942215072 2:173711001-173711023 AGGGTAGGGCAAAAAGGGGTGGG + Intergenic
946149625 2:217755490-217755512 GGGGTAGGGGTAGAAGGTGGAGG - Intronic
946159233 2:217826032-217826054 AGGGCAGGGCCAGGTGGGGCTGG - Intronic
946622057 2:221572067-221572089 AGCGCAGGGCCAGGTGGTGCGGG - Intronic
948767134 2:240228278-240228300 AGCCCAGGGCCAGGAGGTGCTGG + Intergenic
1169224424 20:3847171-3847193 AAGGTAGGGCCAGAAGGGGACGG + Intronic
1169539564 20:6584165-6584187 AGGTGGGGGCCAGGAGGTGCAGG - Intergenic
1169752345 20:9007132-9007154 AGGACACAGCCAGAAGGTGCTGG + Intergenic
1170124780 20:12950573-12950595 AGGGTGGGGCCAAAAGCTGGGGG - Intergenic
1170949845 20:20926615-20926637 AGGGCTGGGCCGGAAGGTCCAGG - Intergenic
1171216533 20:23356469-23356491 CAGGTAGGGCCAGATGGTCCCGG + Intergenic
1171242351 20:23581973-23581995 AGGGAAGGGCCATCAGGTGGGGG + Intergenic
1172433009 20:34908136-34908158 AAGGGAGAGCCAGATGGTGCTGG + Intronic
1174136534 20:48384305-48384327 AGGGTGGGGGCGGAAGGGGCGGG - Intergenic
1175305677 20:57974038-57974060 AGGGTCAGGCCACCAGGTGCTGG + Intergenic
1175614057 20:60377574-60377596 AGGGTGGGTCAAGAAGGTGGTGG + Intergenic
1175687271 20:61040763-61040785 AGGGAAGGGTCAGGAGATGCAGG + Intergenic
1175723814 20:61303434-61303456 AGAGCAGGGCCAGACGGGGCAGG - Intronic
1176085387 20:63293430-63293452 AGGGTGTGGCCAGGAGGGGCCGG + Intronic
1176252193 20:64130710-64130732 GGGGTAGGGGAAGGAGGTGCTGG + Intergenic
1176264715 20:64203150-64203172 AGGCTGGGGCCGGAAGGTGCAGG + Intronic
1178513404 21:33226456-33226478 GGGGTAGGGCCAAAAGTTCCAGG + Intergenic
1178959042 21:37047399-37047421 AGGGAAGGGCCATCAGGTGGGGG - Intergenic
1179036271 21:37760900-37760922 AGGGGAGGGCCAGACGGTCTTGG + Intronic
1181006188 22:20014802-20014824 TGAGTAAGGACAGAAGGTGCAGG - Intronic
1181609349 22:24002142-24002164 AGGGTAGCCCCTGGAGGTGCAGG + Intergenic
1182089634 22:27585218-27585240 AGGCTAAGGCCAGAATGTGAAGG + Intergenic
1182260882 22:29072777-29072799 AGGGTAGGATCAGCAGGTGAGGG - Intergenic
1182357853 22:29730312-29730334 GTGGGAGGGCCAGAAGGTGGGGG - Exonic
1182618987 22:31608005-31608027 CTGGGAGGCCCAGAAGGTGCTGG + Exonic
1183007112 22:34912663-34912685 AGGGTGGGGCTAGAATGTGCTGG + Intergenic
1183100940 22:35583633-35583655 AGGGTATGGCTAGTAGGAGCTGG + Intergenic
1183345336 22:37304317-37304339 AGGGTGGGGCCAGAGGGTCCAGG + Intronic
1184775519 22:46620985-46621007 AGGGGTGGGCCTGTAGGTGCAGG + Intronic
1184948161 22:47818805-47818827 AGGCTAAGGGCAGAAAGTGCAGG + Intergenic
1185128447 22:49024554-49024576 AGGGTCTGGCCAGGAGATGCTGG - Intergenic
949947732 3:9203568-9203590 AGGGTGTGGGCAGAGGGTGCAGG - Intronic
950303626 3:11901820-11901842 AGGGTGGGTGCAGAAGGTGATGG + Intergenic
953476754 3:43211865-43211887 AAGCTAGGGACAGAAGGTACAGG + Intergenic
954404448 3:50337638-50337660 AGGCGAGGGCGGGAAGGTGCGGG + Intronic
954463285 3:50639815-50639837 AGTGTAGAAGCAGAAGGTGCTGG - Intronic
957893633 3:86390657-86390679 TGGGGTGGGCCAGAAGGTGCAGG - Intergenic
962597248 3:136959155-136959177 AGGGTGGGGCCTGAATATGCTGG - Intronic
963678688 3:148347389-148347411 TGGGGAGTGCCAGACGGTGCAGG + Intergenic
965429519 3:168568940-168568962 AGAGGAGGGCCAAAAGGAGCTGG - Intergenic
966620182 3:181954979-181955001 GGGGCAGGGCCAGGAGGTCCAGG - Intergenic
966825316 3:183960240-183960262 AGGGCAGGGCCAGAATATGGAGG - Intronic
967243670 3:187465786-187465808 AGGGAATGGCAAGAAGGTGGGGG + Intergenic
968084093 3:195866959-195866981 AGGGGAGTGCCACAAAGTGCTGG - Exonic
968233363 3:197017012-197017034 AGGGTGGGACCAGGAGGGGCAGG - Intronic
969831842 4:9804280-9804302 AGGGTAGTGCCAGCAGGTCTAGG + Intronic
969927866 4:10602068-10602090 AGTGTTGGACCTGAAGGTGCTGG - Intronic
971183118 4:24349404-24349426 AGGGAAGGGCCATCAGGTGGGGG + Intergenic
974075694 4:57166304-57166326 AGGCAAGGGCCAGAATGTGAAGG + Intergenic
975098185 4:70481528-70481550 AGGGTAGTTGCAGAAGGTGTGGG - Exonic
975527964 4:75372269-75372291 AGAGAAGGGCCAGAAAATGCAGG + Intergenic
977746787 4:100558772-100558794 AGGGAAGGACCATAAGGTGGGGG - Intronic
979516191 4:121612861-121612883 AGGGGTGGGAAAGAAGGTGCGGG + Intergenic
981914773 4:150021940-150021962 AGGATGGGGCCATATGGTGCAGG - Intergenic
982206384 4:153000211-153000233 AGGGCATGGCCAGATGGTTCAGG - Intergenic
982253153 4:153427524-153427546 ATACTGGGGCCAGAAGGTGCAGG - Intergenic
991097164 5:62751524-62751546 AGGGTGGGAACAGAAGCTGCAGG + Intergenic
992269411 5:75050849-75050871 AGGGCTGGGTCAGAGGGTGCAGG - Intergenic
993743019 5:91563166-91563188 AGGGAAGGGCCATCAGGTGGTGG - Intergenic
998140579 5:139697493-139697515 AGGGGAGGGCCAGAAGGCGTAGG - Intergenic
998570094 5:143249371-143249393 AGGGTAGGGCTAGAAAGGGCTGG - Intergenic
999127807 5:149259249-149259271 AGGGAAGGGTCAGGAGGTGCTGG - Exonic
999305688 5:150518067-150518089 AGAGCAGGGCAAGAAGGAGCAGG - Intronic
1001724623 5:173886819-173886841 AGGGTAGAGCCAGAAGTAACTGG - Intergenic
1002054478 5:176590750-176590772 GGGGTAGGGGTAGAAGGAGCTGG + Intronic
1002168704 5:177363296-177363318 AGAGCAGGGCCAGGAGGGGCGGG + Intronic
1003063156 6:2877767-2877789 AGGGAAGGACCAGCAGGTGGGGG - Intergenic
1003223585 6:4184610-4184632 AGGGTGGGGGTAGAGGGTGCTGG - Intergenic
1003894076 6:10590461-10590483 AGGGTAGAGACAGAGGGTGTGGG - Intronic
1006151971 6:31994548-31994570 AGGGCTGGCCCAGCAGGTGCTGG + Exonic
1006158273 6:32027286-32027308 AGGGCTGGCCCAGCAGGTGCTGG + Exonic
1006244373 6:32717545-32717567 AAGGCAGGGACAGAAGCTGCTGG - Intergenic
1006423466 6:33949675-33949697 AGGCAAGGGCCAGATGGTGAAGG - Intergenic
1006672053 6:35735702-35735724 AGAGTGGGGACAGAAGTTGCGGG + Intergenic
1006793004 6:36715917-36715939 AGGACAGGGCCGGGAGGTGCAGG - Intronic
1006826437 6:36939362-36939384 AAGGTAGGGCCCGATGGTGGGGG + Intergenic
1007464794 6:42044178-42044200 AGGCTCCGGCCAGAACGTGCAGG - Intronic
1010679343 6:78781329-78781351 AGGGAAGGACCATCAGGTGCGGG - Intergenic
1011431296 6:87289756-87289778 AGTGTTGGGCAAGAAGTTGCTGG - Intronic
1012114021 6:95270823-95270845 AGGGTAGGGTAAGATGGTGCAGG - Intergenic
1012268935 6:97183586-97183608 GAGGAAGGGGCAGAAGGTGCTGG - Intronic
1012306810 6:97669101-97669123 AGGGGTGGGCCAGAGGGTGGGGG - Intergenic
1012635020 6:101527042-101527064 AGGGTAGGGCCAGACTTTGCTGG - Intronic
1013428851 6:110038247-110038269 TGGGCAGGGCCAGAAGGGCCAGG + Intergenic
1015440783 6:133242984-133243006 AGGGCAGGGGAGGAAGGTGCAGG + Intronic
1015609803 6:135004545-135004567 TGGGCAGGGCCAGACAGTGCAGG + Intronic
1018034619 6:159871612-159871634 AGGGGAGGGCCATAGGCTGCAGG + Intergenic
1018167835 6:161116179-161116201 AGGGTAGGGAAAGAAGCAGCTGG + Intronic
1018302620 6:162419519-162419541 AAGGTTGAGCCAGCAGGTGCAGG + Intronic
1018871987 6:167790430-167790452 GGGGTAGGGGCAGATGGTGAGGG - Intronic
1019049894 6:169174925-169174947 AGGGCAGGGGCGGAAGGTGGCGG - Intergenic
1019051951 6:169190329-169190351 GGGGAAGGGCCGGGAGGTGCAGG - Intergenic
1019142665 6:169957876-169957898 AGGGGAGGGCCGTAGGGTGCAGG - Intergenic
1019498985 7:1355052-1355074 AGGGGAGGGGCGGCAGGTGCAGG - Intergenic
1022795418 7:33727873-33727895 GGGGTAGGGTGAGGAGGTGCTGG - Exonic
1025003778 7:55339789-55339811 AGAGTAGGCCCAGAAGGGGAGGG + Intergenic
1029872035 7:103704710-103704732 AGGGAAGGAGCAGAAGGTGGGGG - Intronic
1033715947 7:144002784-144002806 AAGCCAGGGCCAGAAGGTGCAGG - Intergenic
1034534661 7:151719432-151719454 AGGGCAGGGGCTGAGGGTGCTGG - Intronic
1034542098 7:151764779-151764801 GGGGCAGGGCCAGCAGGTGGGGG + Intronic
1035011961 7:155727215-155727237 GGGGCAAGGGCAGAAGGTGCAGG + Intronic
1035284760 7:157799140-157799162 GGGGTGGGGCCAGCAGGAGCAGG + Intronic
1036123992 8:6046579-6046601 AGAGTAGGGCCAGAAGCTGGGGG + Intergenic
1037585113 8:20270726-20270748 GGGGTAAGGCCAGAAGGGGAGGG - Intronic
1038120413 8:24608084-24608106 AGGGAAGGGCCAGAAGATCCAGG + Intergenic
1038530912 8:28317383-28317405 AGGGCAGGGCCACCAGGGGCTGG + Intronic
1039095537 8:33880828-33880850 AGGGTAGGACCATCAGGTGGGGG + Intergenic
1039784339 8:40819463-40819485 AGGCTAGGGGCTGAAGGTGGGGG - Intronic
1044429843 8:92095715-92095737 AGGATGGGGCCAGAAAGTGGGGG + Intronic
1044874275 8:96648898-96648920 AGGTTAGGGCCAGACAGTGATGG + Intronic
1045001169 8:97879449-97879471 AGGGAAGGGCCAGTAGATGAGGG + Intronic
1045577466 8:103440560-103440582 GAGGTAGGGACAGAAGATGCAGG + Intronic
1046612908 8:116445310-116445332 GGGGGAGGGGCAGAAGGTGGAGG + Intergenic
1047079359 8:121442886-121442908 AAGGCAGGGACAGAAGCTGCTGG - Intergenic
1049416475 8:142497765-142497787 TGGGTAGGGGCAGCAGGGGCTGG + Intronic
1049417831 8:142503615-142503637 TGGGGAGGGGCAGCAGGTGCGGG + Intronic
1049439788 8:142604065-142604087 AGGGTGGGGGCACAAGGTCCTGG + Intergenic
1049487748 8:142875303-142875325 AGGGTAGAGCCTGGAGGTGGGGG + Exonic
1049492520 8:142912876-142912898 AGGGTAGAGCCTGGAGGTGGGGG + Exonic
1049761764 8:144334833-144334855 AGGGTAGGACCCAAGGGTGCAGG - Intronic
1049770250 8:144376794-144376816 TGGCTAGGGTCAGGAGGTGCAGG + Intronic
1050245919 9:3689576-3689598 AGGGGAGAGCCAGAAGGGGAGGG + Intergenic
1050784853 9:9388190-9388212 AAGGTAAGGACAGAAGTTGCTGG - Intronic
1053161100 9:35813925-35813947 AGGGTAGGGCCAGAAGGTGCTGG + Intronic
1054813630 9:69454583-69454605 AGAGCAGGGCCAGAGTGTGCTGG - Intronic
1056381067 9:86057705-86057727 CGTGGAGGGCAAGAAGGTGCTGG + Intronic
1057141032 9:92726931-92726953 AGAGAAGGGGCAGAATGTGCTGG + Intronic
1057525919 9:95801067-95801089 AGGATGTGGCCAGAAGGTGGGGG - Intergenic
1058277495 9:103063335-103063357 AGAGTAGGGGAATAAGGTGCTGG + Intergenic
1059712502 9:116882133-116882155 AGTGCAGGGCCAGAAAGAGCAGG - Intronic
1060485252 9:124042347-124042369 AGGGCAGGGCCAGGAGGGGGAGG - Intergenic
1060781210 9:126414608-126414630 AGGATAGTGCCAGGAGGTGAAGG - Intronic
1060826755 9:126692152-126692174 TGGGTAGGGACAGATGGTGGTGG - Intronic
1060828875 9:126701653-126701675 AGGGCAGGGCCAGACCGTTCAGG + Intergenic
1061817391 9:133205339-133205361 AGGGTAGGTCCAGGTGGTCCAGG + Exonic
1061926261 9:133807496-133807518 AGTGCAGGGCAGGAAGGTGCGGG + Intronic
1062243012 9:135549887-135549909 AGGGTAGGTCCAGGTGGTCCGGG - Exonic
1062288886 9:135785838-135785860 AGGGCAAGGCCAGGATGTGCTGG + Intronic
1188125604 X:26364682-26364704 AGGGCAGGGCAAGAAAGAGCAGG - Intergenic
1189201894 X:39203613-39203635 AGGGTAGAGCAAGCAGGGGCAGG + Intergenic
1189472051 X:41322183-41322205 AGGGCAGGGCCAGCAAGGGCAGG + Intergenic
1189544180 X:42024455-42024477 AGGATAGGGGCAGGAGGAGCTGG + Intergenic
1190259071 X:48786684-48786706 AGGGTAGGGGCAGCAGGCCCAGG - Intronic
1190337185 X:49269801-49269823 GGGGCAGGGCCTGAAGGGGCGGG - Intergenic
1190712597 X:53081367-53081389 AGGGAAGGGGCAGAAGTTGGGGG + Intergenic
1192758119 X:74066981-74067003 AGGGCAGGGCCAGCAAGGGCAGG - Intergenic
1196691898 X:118568665-118568687 AGGGTGGTGCAGGAAGGTGCAGG + Intronic