ID: 1053161506

View in Genome Browser
Species Human (GRCh38)
Location 9:35816639-35816661
Sequence TTGAATTAGTTTTAGGTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 287}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053161504_1053161506 1 Left 1053161504 9:35816615-35816637 CCTAACTCTATTGTTGACTATTA 0: 1
1: 0
2: 1
3: 17
4: 173
Right 1053161506 9:35816639-35816661 TTGAATTAGTTTTAGGTGAATGG 0: 1
1: 0
2: 1
3: 22
4: 287
1053161503_1053161506 26 Left 1053161503 9:35816590-35816612 CCTTCAATGAGTTTATCATAGTA 0: 1
1: 0
2: 2
3: 7
4: 174
Right 1053161506 9:35816639-35816661 TTGAATTAGTTTTAGGTGAATGG 0: 1
1: 0
2: 1
3: 22
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053161506 Original CRISPR TTGAATTAGTTTTAGGTGAA TGG Intronic
900722978 1:4190297-4190319 TTGAGTTAATTTTTTGTGAAGGG + Intergenic
900976372 1:6019284-6019306 TTTAATTTTTTTTAGGAGAAGGG - Intronic
901155146 1:7131613-7131635 GTGAATTGGTTTTCAGTGAAGGG - Intronic
902061609 1:13648454-13648476 TAGAAATATTTTGAGGTGAATGG - Intergenic
903089536 1:20899383-20899405 TTGCATTCGTTTTAATTGAAAGG - Intronic
905560322 1:38921456-38921478 ATGAATGAGTTTTAGATGGATGG + Intronic
907762136 1:57371380-57371402 TTGAATTGGTATTGGCTGAACGG - Intronic
909623338 1:77689028-77689050 TTGAATTAGTGGGAAGTGAAAGG + Intergenic
909802273 1:79825055-79825077 TTTAATTAGTATTAGGTGTTTGG - Intergenic
909803833 1:79849804-79849826 TTGTAATATTTTTAGGTGAGTGG - Intergenic
910507585 1:87967763-87967785 TTGAATTAGTACTATGTGACAGG - Intergenic
911779191 1:101854204-101854226 TTGAAGGAGATTTGGGTGAAAGG - Intronic
911993849 1:104737310-104737332 TTCAATGAGTTTTAGGATAAAGG + Intergenic
912146724 1:106803274-106803296 TTGAATTAGTCATTGTTGAATGG + Intergenic
915000783 1:152588180-152588202 TTGGAATAGTTTTAGTAGAATGG - Intronic
918414649 1:184294044-184294066 TTGAAATGATTTTAGGTGAAAGG + Intergenic
918833071 1:189423555-189423577 TTGTATTTGTTTTAGGTTAAGGG + Intergenic
918850362 1:189680113-189680135 TTGACCTATTTTTATGTGAATGG + Intergenic
918928343 1:190817286-190817308 TTGAGTTAGTTTTTTATGAAGGG + Intergenic
921695846 1:218209093-218209115 CTGAATTAGTTTTATGAGAAGGG - Intergenic
921819505 1:219601198-219601220 TTGAATAAGTTTTGAGTCAAGGG + Intergenic
921931689 1:220759695-220759717 TGGAATCAGTTTTAGGGGAAAGG + Intronic
922533163 1:226359895-226359917 TTGAATTTTTTTAAAGTGAAGGG + Intergenic
923441600 1:234025967-234025989 GTGAGTTAATTTGAGGTGAAAGG + Intronic
923882489 1:238118779-238118801 TTCAGATAGTTATAGGTGAAAGG + Intergenic
1063148294 10:3315706-3315728 TTGAAATAATTTTAGGTATAGGG - Intergenic
1065102899 10:22348621-22348643 TTGAATTTATTCTATGTGAAAGG + Intronic
1067113868 10:43420127-43420149 TTAAATTATTTTTTGTTGAAGGG + Intergenic
1067179803 10:43976226-43976248 TTTAACCAGTTTTAGGTGTATGG + Intergenic
1067514261 10:46923409-46923431 TTGAGTTATTTTTTTGTGAAAGG + Intronic
1067647993 10:48128422-48128444 TTGAGTTATTTTTTTGTGAAAGG - Intergenic
1067655968 10:48191519-48191541 TTGATTTAGTTTGTGGTGCACGG + Intronic
1068367220 10:56067522-56067544 TTTCTTTAGTTTCAGGTGAAGGG + Intergenic
1069045159 10:63735624-63735646 TTGAATTCCTTCTATGTGAAAGG + Intergenic
1074482501 10:113837618-113837640 TAGAAATAATTTTATGTGAATGG + Intronic
1074792992 10:116910871-116910893 TTGCTTTAGTTTTAAGTGAGTGG - Intronic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1075672231 10:124270519-124270541 ATGGATGAGCTTTAGGTGAAGGG - Intergenic
1076123706 10:127957232-127957254 TTGAGTTAATTTTTTGTGAAGGG + Intronic
1077754265 11:5008715-5008737 TTGAATGAGATTTGGGAGAATGG + Intergenic
1079218916 11:18541657-18541679 TTGAAATAGCTTTAGCTCAAAGG + Intronic
1079492879 11:21009305-21009327 TTCAATTACTGTTAGCTGAATGG - Intronic
1080236797 11:30079428-30079450 GTGAATTAGCTTTTGGAGAAGGG + Intergenic
1081259613 11:40943640-40943662 TTGAAATTGTTTTCTGTGAAGGG + Intronic
1084912226 11:72399781-72399803 TTGAATTAGATTTCGATGAAGGG - Intronic
1086430048 11:86727886-86727908 TTGAATTCTTTTTAGGTGTCAGG - Intergenic
1086471581 11:87118910-87118932 CTGGATTAGGTTTTGGTGAAGGG + Intronic
1088039902 11:105367525-105367547 TTTATTTAGTTTTATGTCAAGGG - Intergenic
1088308526 11:108435774-108435796 TTACATTTGTTTTAGGGGAATGG - Intronic
1088326313 11:108604826-108604848 TGAAATCAGTTTTAGGTTAAAGG + Intergenic
1088618643 11:111659762-111659784 TTTTATTACTTTTAGCTGAAAGG - Intronic
1090679976 11:129045008-129045030 ATGAATTAGGTTTAGGTATATGG + Intronic
1092125765 12:6074035-6074057 CTGAAAGGGTTTTAGGTGAAGGG - Intronic
1092678090 12:10944748-10944770 TTGAAATAGTTTAACATGAAGGG + Intronic
1093627589 12:21367883-21367905 TTGAGGTAGTTTTAAATGAAAGG - Intronic
1094308041 12:29043183-29043205 TTGAGTTAATTTTCAGTGAAAGG + Intergenic
1095883711 12:47166531-47166553 ATGAATTAATTATAGTTGAATGG + Intronic
1095918149 12:47501141-47501163 TTGAATTAGTTTCAGAAGGATGG - Intergenic
1096856088 12:54484298-54484320 TTAAATTAGTCTTAGGAGAAAGG - Intergenic
1097592004 12:61586393-61586415 TAGAGTTAGTTTTAAGTGATTGG + Intergenic
1097778716 12:63678623-63678645 TGAAATTAGTTTTAAGTGTATGG + Intergenic
1098012386 12:66067136-66067158 TTGAATTTGGTCTTGGTGAATGG - Intergenic
1098205315 12:68102996-68103018 TTGACTTGGTTTTACGTTAAAGG - Intergenic
1098216056 12:68221158-68221180 TTTATTTAGTTTTAGTTGACTGG - Intronic
1099288277 12:80743074-80743096 TTGACTTTGTTTTAGATTAAGGG + Intergenic
1099357410 12:81655530-81655552 TTGAATTATTTTTTGGCCAATGG + Intronic
1101683691 12:106995282-106995304 AAGAATTAGTTTTGGGAGAAGGG - Intronic
1105253401 13:18721446-18721468 TTGAATGAGTTTATGGTGAGAGG + Intergenic
1105833215 13:24184145-24184167 CTGAATAAGTTTTGAGTGAATGG + Intronic
1106380749 13:29236506-29236528 TTGAAATAGCTTGTGGTGAAAGG + Intronic
1107293134 13:38880126-38880148 TTGAATGAGTACTAGGTGCAAGG - Intronic
1107646668 13:42501226-42501248 TTGAATTCTTTGTAGATGAAAGG - Intergenic
1108853908 13:54769984-54770006 TTTAATTAGTTTAAGGTGTGTGG + Intergenic
1109502954 13:63261474-63261496 TTGAATTATTTTTGGGTCCAAGG - Intergenic
1110800188 13:79685099-79685121 CTGTATTAGTTTCAGCTGAAAGG - Intergenic
1110905599 13:80884503-80884525 TTAAATTAGTTTTAAGAGCAAGG + Intergenic
1115372602 14:32634908-32634930 TTCAATAAGTTTTTGGGGAACGG + Intronic
1116503287 14:45647209-45647231 CTGGATTTGTTTTAGGTAAAGGG + Intergenic
1117327827 14:54685037-54685059 CTGAAAAAGATTTAGGTGAATGG + Intronic
1118329172 14:64802409-64802431 ATGAATTAGTGTTAAGTGAAGGG - Intronic
1119108337 14:71946121-71946143 TAGACTTTTTTTTAGGTGAAGGG + Intronic
1120029772 14:79628073-79628095 TTCAATTACTTTTATGTCAACGG - Intronic
1120258716 14:82155024-82155046 TTATATTTGTCTTAGGTGAAGGG - Intergenic
1120270155 14:82302225-82302247 TTGAGTTAATTTTTCGTGAAGGG + Intergenic
1124938041 15:34191585-34191607 GTTAATTATTTTTAGTTGAATGG + Intronic
1126562117 15:50055279-50055301 TTGACTTAGTTTGAGTTGAATGG - Intronic
1128584579 15:68837031-68837053 TTGAAGTATTTTTTGGTGGAGGG - Intronic
1133389870 16:5401571-5401593 TTGAATCATTTTTAGGGGAAGGG - Intergenic
1135516163 16:23136797-23136819 TTGAATTAGTTTTTTGTTAGTGG - Intronic
1137076727 16:35974886-35974908 TTGGATCACTTTTAGGTGTATGG - Intergenic
1137846990 16:51699647-51699669 TTGGATAAGGTTTAGGTGAGGGG - Intergenic
1138863000 16:60781892-60781914 ATGTATAAGTTTCAGGTGAAAGG + Intergenic
1139075311 16:63439778-63439800 TTGAACTAACTTTAGGTGTAGGG + Intergenic
1143604436 17:7973907-7973929 TTGCATTTGTTTTATGAGAAAGG - Intergenic
1148523123 17:48301075-48301097 TTGTTTTAGTTTTAGGAGAGGGG - Intronic
1148835598 17:50464141-50464163 CTGAATGAGCTGTAGGTGAAAGG + Intronic
1149440256 17:56667886-56667908 TTGAATTAGTTTTAAAAGGATGG - Intergenic
1150963668 17:69942183-69942205 TTTAATTTGCTTTAGTTGAAAGG + Intergenic
1151014901 17:70542950-70542972 TTTATTTAGTTTTATGTAAATGG + Intergenic
1151847013 17:76663683-76663705 TTGAGTTACTTTTTGTTGAAGGG - Intergenic
1152540952 17:80974944-80974966 TTGAATTAGTTTTCAGTACATGG - Intergenic
1153127021 18:1806019-1806041 TTGTATTAGTGAGAGGTGAATGG - Intergenic
1153538513 18:6129693-6129715 TTGCATTTGTTCTAGGTGACTGG + Intronic
1153763166 18:8351128-8351150 TTCAATTAGTATTAAATGAAGGG - Intronic
1154088462 18:11331781-11331803 TTGAGTTAATTTTTTGTGAAGGG + Intergenic
1155842562 18:30664045-30664067 TTGTATAAGTTGTAAGTGAAGGG - Intergenic
1159145129 18:64444533-64444555 TTGATTGAGTTTTTAGTGAATGG + Intergenic
1160090220 18:75819776-75819798 TTGAAATACTGTTAGCTGAAGGG + Intergenic
1160321906 18:77904454-77904476 TTGAAATAGATGTAGGTAAAGGG - Intergenic
1160536251 18:79595590-79595612 TTGAGTTAATTTTTTGTGAAAGG - Intergenic
1161526165 19:4757032-4757054 CTGAATCCTTTTTAGGTGAACGG - Intergenic
1163889296 19:19996799-19996821 TTCAATAGGTTTTAGGGGAACGG - Intergenic
1164124238 19:22296177-22296199 TTGGAATAGTTTTAGTAGAATGG + Intronic
1165956430 19:39504445-39504467 TTGAAGTAGGATTAGGTGATGGG + Intronic
925455467 2:4012935-4012957 TTCAATTATTTTTAAGTGTATGG + Intergenic
926071160 2:9892937-9892959 TTAAATTAATTTTGAGTGAAGGG + Intronic
927606895 2:24493112-24493134 TAGAAATAGTTTTGGGTTAAAGG + Intronic
928319049 2:30268705-30268727 TTGAATTAGTCCTAGGTGAAAGG - Intronic
930145449 2:47998041-47998063 TTGAATAACTTTTATGTGATAGG - Intergenic
930931629 2:56890989-56891011 TTGAATTAATTTTTTGTGATTGG + Intergenic
931353354 2:61512204-61512226 ATGAATTTGTTTTAGATGCAAGG + Intronic
932988905 2:76762468-76762490 TTGAAGTAGTTTGGGGTGAAGGG - Intronic
933295668 2:80488141-80488163 GTGAATTAGTTTTTGGATAATGG + Intronic
935439744 2:103078048-103078070 TTGGAATAGTTTTAGTTGATTGG + Intergenic
935882299 2:107576625-107576647 TTGTTTTAGTGTTAGTTGAAAGG - Intergenic
936771745 2:115921839-115921861 TTTGCTTAGTTTTAGGTGACAGG - Intergenic
937289615 2:120774180-120774202 TTGTACTAGTTATTGGTGAATGG - Intronic
937621185 2:123989013-123989035 TTGAATAAGTTATAGGTTTAGGG - Intergenic
938045658 2:128117407-128117429 TAGAATTTGCTTTATGTGAAAGG + Intronic
939181216 2:138804526-138804548 TGAAATTAGTTTTAGTTGCATGG + Intergenic
939292106 2:140209540-140209562 ATGAATTATTTTTACTTGAATGG + Intergenic
939681797 2:145145031-145145053 TTGAATGAATATTATGTGAAAGG + Intergenic
940474163 2:154139505-154139527 TTAAATTAGGTTAAAGTGAAAGG - Intronic
941551354 2:166919279-166919301 TTGAATTTGTTTCAGGTGTTTGG - Intronic
941653241 2:168116199-168116221 TTGAAGTTGTTTTGGGTGAGGGG - Intronic
941709827 2:168700288-168700310 TTCAGTTAGTTTTAGGGGAAAGG + Intronic
941821746 2:169850519-169850541 CTGTAAGAGTTTTAGGTGAAGGG + Intronic
942301139 2:174563636-174563658 ATGAATTTTTTTTATGTGAATGG - Intronic
942890038 2:180978658-180978680 TTCAATTACTTTTATGTAAAAGG - Intronic
943440880 2:187926335-187926357 TTAAATTAATTTAAGGTTAAAGG + Intergenic
944473403 2:200079694-200079716 TTTATTTAGTTTTATGTAAAAGG - Intergenic
945593505 2:211763936-211763958 TTGAGTTCTTTTTAAGTGAAAGG - Intronic
946429774 2:219619118-219619140 TGGATTTAGTTTCAGGTGAGAGG - Intergenic
1170007947 20:11689191-11689213 TTGAATTAGATTGAGGAGTAGGG - Intergenic
1170241996 20:14176784-14176806 TTGTATTATTTTGAGGTAAAGGG - Intronic
1170804892 20:19621000-19621022 TGGAATGAGTTTGATGTGAAAGG + Intronic
1170987940 20:21275290-21275312 TTGAATTGGTTTCTGGTCAAAGG + Intergenic
1174816694 20:53693201-53693223 TTTAACTAGTTTTTGGGGAACGG - Intergenic
1175250177 20:57604427-57604449 ATGAATCAGTTTTGGGGGAATGG - Exonic
1176838912 21:13821381-13821403 TTGAATGAGTTTATGGTGAGAGG + Intergenic
1177396563 21:20543579-20543601 GTGAATCTGTTTTTGGTGAATGG + Intergenic
1177416576 21:20800946-20800968 TTCAATTATTTTTAATTGAAGGG - Intergenic
1181373852 22:22440633-22440655 ATTAATGAGTTTTAGATGAAAGG - Intergenic
1181970683 22:26687472-26687494 TGGAATTAGGTTTAAGGGAAGGG + Intergenic
1182989563 22:34754154-34754176 TTGAATTAAGCTAAGGTGAATGG + Intergenic
952475253 3:33702948-33702970 TTGAGTTAATTTTTGGTGAAGGG - Intronic
955176735 3:56622324-56622346 TTAAATTAGTTTTAGCAAAATGG - Intronic
955482467 3:59403422-59403444 TTGAATTAATTTGAATTGAATGG - Intergenic
956117020 3:65929253-65929275 TTGAGTTAGATTGAGGAGAAAGG - Intronic
957185111 3:76931225-76931247 TTGATTAATTTTTAGGTTAAAGG + Intronic
957509668 3:81170923-81170945 TTGCATGAGTTTCAGGAGAATGG + Intergenic
958111895 3:89158815-89158837 TGGAATTAGTTCTATTTGAAAGG + Intronic
959371167 3:105527869-105527891 TTGAATGACTTTTAGGAGGAGGG - Intronic
962507574 3:136063252-136063274 TTGAATTAATTTTTGGTATAAGG - Intronic
962838429 3:139210792-139210814 TTGAGTTAATTTTTTGTGAATGG + Intronic
963150577 3:142041819-142041841 TTGAGTTAATTTTTTGTGAAAGG + Intronic
964056435 3:152466046-152466068 TTGAAATAGTTTTAAGTGTCAGG + Intergenic
964237322 3:154546729-154546751 TTGCATTATTTTTGGGTGCATGG + Intergenic
964381660 3:156103812-156103834 TTGAATTAGCTCCAGGTGAAAGG + Intronic
964886342 3:161487908-161487930 TTGAAATAGTTTTAGGCACATGG - Intergenic
964909433 3:161760559-161760581 ATGAATTAGGTTTAGGTTTAAGG - Intergenic
964944057 3:162196852-162196874 TTGAGTTTGTGTGAGGTGAATGG + Intergenic
965028824 3:163336512-163336534 TTAAATTAGTATTAGGTGGTGGG - Intergenic
965157452 3:165082415-165082437 TTGAATTATTTTGTGGTGAGAGG - Intergenic
965219325 3:165906123-165906145 TTGAAGTAGTATAAAGTGAATGG + Intergenic
965594424 3:170396190-170396212 TTAAATTAGTTTAATGTAAAAGG + Exonic
965931653 3:174051082-174051104 TTTAATTTGTTTTAGGTAATGGG + Intronic
966594159 3:181711583-181711605 TTGATTTACTTTTTGGTGCAGGG - Intergenic
967066579 3:185922823-185922845 TTAAATTCTATTTAGGTGAAAGG - Intronic
970096882 4:12473679-12473701 TTGAATTACTTTTATATGACAGG + Intergenic
970336020 4:15043613-15043635 TAGAAATAGTTTAAGTTGAAAGG - Intronic
970390949 4:15613253-15613275 TTGAATTAGTCTGTGGTGGATGG + Intronic
970488310 4:16546343-16546365 TTAAATTAGTTTTACGTGGTAGG - Intronic
972494174 4:39617676-39617698 TTGCCTCAGATTTAGGTGAAAGG - Intronic
972901233 4:43686280-43686302 TTGAATAAGTTATATGTGGAAGG + Intergenic
974865962 4:67581016-67581038 TTGAATTAGCTTTTAGTGCAAGG + Intronic
974875256 4:67696286-67696308 TTGTTTTAGGTTTAGGTGATAGG - Intronic
976466555 4:85376108-85376130 GTGAATGAGGTTTAGGGGAATGG - Intergenic
976492571 4:85688742-85688764 TTGATTTTTTTTAAGGTGAAAGG + Intronic
976494209 4:85708013-85708035 TTGGACTAGTTTTAGGTCAGAGG + Intronic
977491461 4:97717784-97717806 TCAAAGTGGTTTTAGGTGAAGGG - Intronic
978227734 4:106358168-106358190 TTAAATAAAATTTAGGTGAAAGG - Intergenic
978619594 4:110625312-110625334 TTGACTTAGTTATAGGTCATCGG - Intronic
978743773 4:112168131-112168153 TTGTTTTAACTTTAGGTGAATGG - Intronic
978830533 4:113078842-113078864 TTGCATTATTTTTATGTGAATGG - Intronic
980095506 4:128486154-128486176 ATCAATTAGTTGTAGGTGTATGG - Intergenic
980496756 4:133595028-133595050 TTTATTAAGTTTTACGTGAAGGG - Intergenic
980529014 4:134026478-134026500 TTGAAATAATTCTAGGTGACAGG - Intergenic
980681050 4:136160530-136160552 TTAAATTTATTTTAGGTAAACGG - Intergenic
980710720 4:136563807-136563829 TTGACTCAGTTTTAAGTGAGAGG + Intergenic
982461982 4:155681923-155681945 TTGAATTTGTTTTAGATACATGG - Intronic
984409914 4:179384194-179384216 TTCTTTTAGTTTTATGTGAATGG + Intergenic
984472233 4:180190928-180190950 TTGAAGAAGTTTGAGGTGTAAGG + Intergenic
984484800 4:180354172-180354194 TTTATTTAATGTTAGGTGAATGG - Intergenic
985059540 4:186063002-186063024 ATGAAATGGATTTAGGTGAATGG - Intergenic
985186811 4:187326548-187326570 TTGAATTAGAATCAAGTGAATGG - Intergenic
986942138 5:12966630-12966652 TTGACTAAGTATTAGGTGATAGG - Intergenic
987536279 5:19192427-19192449 TTGAATTAGTTTCTGGAAAAGGG + Intergenic
992461300 5:76962709-76962731 ATAAATTTGTTTTAGTTGAAAGG + Intronic
993418979 5:87676257-87676279 GAGAATTAGTTTGATGTGAAAGG + Intergenic
993498026 5:88630214-88630236 TTGAAATAATTTCAAGTGAATGG - Intergenic
993909697 5:93666242-93666264 CTGAATAAGATGTAGGTGAAAGG - Intronic
993975037 5:94469013-94469035 ATCAATGAGATTTAGGTGAAGGG + Intronic
994590451 5:101765506-101765528 TTGAATTGGCTGTAAGTGAAAGG - Intergenic
994902212 5:105789025-105789047 TTCAATTATATTTAGGTGCAAGG - Intergenic
995138294 5:108704243-108704265 TTAAATTATTTTAAGGTGTAAGG + Intergenic
996025144 5:118637526-118637548 TTGAGTTAATTTTTTGTGAAGGG - Intergenic
999109151 5:149102263-149102285 TTGGAATAGTTTGAGGAGAATGG - Intergenic
999620928 5:153472488-153472510 TTGGAATAGTTTCAGGAGAATGG + Intergenic
1001493405 5:172171386-172171408 TTTAATGAGTTATACGTGAAAGG + Intronic
1001884195 5:175273990-175274012 TTGAATTAGTTAAAAGTGAAAGG - Intergenic
1002972296 6:2036103-2036125 TTAAATTAAAGTTAGGTGAAAGG - Intronic
1003522791 6:6872961-6872983 TTGAATTAGCTCTCTGTGAAGGG - Intergenic
1005440271 6:25860122-25860144 TTGCATTATTTTTAGATTAAAGG + Intronic
1007344658 6:41219766-41219788 ATGAACTTGTTTTAGGAGAAGGG - Intergenic
1008060222 6:46989341-46989363 TTAAATTAGTTGTTGGGGAAGGG + Intergenic
1008337806 6:50327443-50327465 TTGAATCAGTTATCGTTGAAAGG - Intergenic
1008696712 6:54047032-54047054 ATGAATAACTTTTATGTGAAAGG - Intronic
1008906198 6:56680219-56680241 TTTACTTAGTTTTAGTGGAATGG - Intronic
1009273101 6:61640452-61640474 TTGAATTGGTCTTAGGTGTTGGG - Intergenic
1009566143 6:65313392-65313414 TTGAATAAGTTTTGAGTCAAGGG - Intronic
1009634048 6:66240692-66240714 TTGAAATAGCTTTAGGACAAAGG - Intergenic
1009651886 6:66487053-66487075 TTGAATTAACTTTAGGTATATGG + Intergenic
1009925985 6:70121413-70121435 TTGAATTAGTTGTAAGAAAATGG - Intronic
1010025733 6:71214059-71214081 TTGAATTTTTTTTAAGTTAAAGG - Intergenic
1010269207 6:73901823-73901845 TTGAATTACTTTCATATGAAGGG - Intergenic
1010960584 6:82141363-82141385 TTGAATTGGTTGCAGGTGAATGG - Intergenic
1011276006 6:85632215-85632237 TTGAAATAGTTTTAGGTATTTGG - Intronic
1011831199 6:91373783-91373805 TTGAAATAGTTTCAGAGGAATGG + Intergenic
1013706880 6:112846283-112846305 CTGAATTAGTTTTCTGAGAAGGG + Intergenic
1014490721 6:122058497-122058519 TTGAATTAGAATGAGGAGAAAGG + Intergenic
1014584913 6:123186036-123186058 TTGAAATAGTTTCAGAAGAATGG - Intergenic
1015268795 6:131317536-131317558 ATGAATTGGCCTTAGGTGAAGGG + Intergenic
1015724123 6:136282407-136282429 TTAAGTTAGTTTTAGGAAAAAGG - Intronic
1016040489 6:139427581-139427603 TAGAATTAGTTTTGGCTGTAAGG - Intergenic
1016765442 6:147787972-147787994 TTGCATAAGTATTCGGTGAATGG + Intergenic
1021667831 7:23004336-23004358 AGGAATTAGTTATTGGTGAAAGG - Intronic
1022020473 7:26395701-26395723 TTGAATTATTTTGAGGGTAAGGG - Intergenic
1022826177 7:34016614-34016636 TTGAATTTATTTTAAGTGATTGG + Intronic
1022937646 7:35196288-35196310 TGAAATTAGTTTTAAGTGTATGG + Intergenic
1023621902 7:42082027-42082049 TTGAATGAGTTTGAGGGGACTGG - Intronic
1026283014 7:68938365-68938387 TTGAATGAGGAGTAGGTGAATGG - Intergenic
1026373421 7:69725151-69725173 TTGACTTTGCTTTAGGGGAAAGG + Intronic
1028106361 7:86883876-86883898 TTAAGTTTGTTTTAAGTGAAAGG - Intronic
1028372481 7:90109308-90109330 TGAAATTAGTTTTAAGTGTATGG - Intergenic
1028439692 7:90845890-90845912 TTCAGTTAGTTTTATGTGAAAGG + Intronic
1028541393 7:91946362-91946384 ATGAATTAGTTTTAAGTCACAGG - Intronic
1031393339 7:121243025-121243047 TTATATTAATTTTAGGGGAAAGG - Intronic
1034757613 7:153637841-153637863 TTGAATCAGTATTAGCTGAGTGG - Intergenic
1036006673 8:4672656-4672678 TTGAAAAAGTTTTGGGAGAAAGG + Intronic
1037557989 8:20044172-20044194 TTTAATTAGATTTAGGGGAATGG + Intergenic
1039593784 8:38772212-38772234 TTGATTAAGGTTTAGGGGAAAGG + Intronic
1039623441 8:39023559-39023581 TTGTACTAGTTTTTTGTGAACGG + Intronic
1040542988 8:48376368-48376390 TTGAAGTGATTTTAGGTGTAAGG + Intergenic
1040753423 8:50739819-50739841 ATGAAATAGTTGTAGGTGTATGG - Intronic
1040808128 8:51418142-51418164 TTGTATTAGCTTTATGTTAAAGG - Intronic
1040857804 8:51968396-51968418 TTGAGTTAATTTTTTGTGAAAGG - Intergenic
1043287421 8:78551074-78551096 TTGAATTACTATGAGGTGAGGGG - Intronic
1044127640 8:88477785-88477807 TTGGAATAGTTTTAGTAGAAAGG - Intergenic
1044787204 8:95807402-95807424 TTGCATTGCTTTTAGGTGTATGG - Intergenic
1045349608 8:101326555-101326577 TTGTAGTAGTTTTAGAGGAAAGG + Intergenic
1046296001 8:112219337-112219359 TTGAAATAGTTTCAGAGGAATGG - Intergenic
1047250652 8:123179857-123179879 GAGAATTAGTTCCAGGTGAAAGG + Exonic
1047886618 8:129257947-129257969 ATGACTTGATTTTAGGTGAAAGG - Intergenic
1048091476 8:131245418-131245440 ATGAATTCATTTTAGGAGAAAGG - Intergenic
1048159878 8:132007072-132007094 TTGACCCAGTTTTAGGTGAAAGG - Intronic
1048894013 8:138972378-138972400 TTGAATTTATTTTTGGTGCAAGG + Intergenic
1049965867 9:779155-779177 CTGAAATAGTTTGAGGAGAATGG - Intergenic
1051055456 9:12979654-12979676 TTGATTTATTTAGAGGTGAAGGG + Intergenic
1051376077 9:16404328-16404350 TTGAATAATTTTTAAGTGTATGG - Intergenic
1051462079 9:17330950-17330972 TTAAATAAGTTTTAGGAGTAAGG + Intronic
1051870700 9:21734710-21734732 TTTAATCTTTTTTAGGTGAAAGG + Intergenic
1052783739 9:32809311-32809333 TTGAGTTAATTTTTTGTGAAGGG - Intergenic
1053161506 9:35816639-35816661 TTGAATTAGTTTTAGGTGAATGG + Intronic
1053841342 9:42190642-42190664 GTGAAGTAGTTCTGGGTGAATGG + Intergenic
1054098399 9:60921408-60921430 GTGAAGTAGTTCTGGGTGAATGG + Intergenic
1054587954 9:66985524-66985546 GTGAAGTAGTTCTGGGTGAATGG - Intergenic
1055769228 9:79699325-79699347 TTGAGTTTGTTTTTGGTGATGGG - Intronic
1056143672 9:83708174-83708196 GCGATTTAGTTTTTGGTGAAAGG - Exonic
1057708709 9:97417727-97417749 TTGATTTGGTTTTGGGGGAAGGG - Intronic
1058548256 9:106084697-106084719 TTGAGTTAGTTTTTGCTGGAGGG + Intergenic
1059005559 9:110398323-110398345 TTGAATTAATTTTTTGTGTAAGG - Intronic
1061602115 9:131677468-131677490 CTAAAATAGTTTTAGGAGAAAGG - Intronic
1187607175 X:20898182-20898204 AGGAATTAGTTGTATGTGAAAGG + Intergenic
1188232396 X:27680863-27680885 TTTAGTCAGTTTTAGGTGATTGG + Intronic
1190482564 X:50891555-50891577 TTGATTCAGTTTTAGAGGAAAGG - Intergenic
1192133757 X:68577430-68577452 TTGAATTAATTTTTTGTAAAAGG + Intergenic
1192972834 X:76251993-76252015 TTATATTACTTTGAGGTGAAAGG + Intergenic
1193296786 X:79842746-79842768 TTGGAATAGTTTCAGATGAATGG - Intergenic
1194262006 X:91707231-91707253 TTTAATTATTTTTAAGTGTATGG - Intergenic
1194845184 X:98798209-98798231 TTGAATCAGTTCTAAATGAAGGG + Intergenic
1195025235 X:100870214-100870236 TTGAAATAGTTTCAGAAGAATGG + Intronic
1195582193 X:106517749-106517771 TTGAATTAGTTATAATTGCATGG - Intergenic
1196257256 X:113535700-113535722 TTGAATTAATTTCAGGTGCAGGG - Intergenic
1196406366 X:115366543-115366565 TTGATTTATTTTTAGTTGTAAGG - Intergenic
1196962336 X:121016750-121016772 TTGAATTATTTATGGGTAAATGG + Intergenic
1199390908 X:147277737-147277759 TTGAATGCATTTTAAGTGAAAGG + Intergenic
1199898063 X:152144051-152144073 TTGGATTAGTTTTTAGTGAAAGG + Intergenic
1200580652 Y:4946018-4946040 TTTAATTATTTTTAAGTGTATGG - Intergenic
1201078395 Y:10206474-10206496 TTGAAGCAGTTTTAGGTCTATGG + Intergenic
1202033642 Y:20606952-20606974 TTGAAATAGTTTTAGTGGAATGG + Intergenic