ID: 1053162158

View in Genome Browser
Species Human (GRCh38)
Location 9:35820615-35820637
Sequence TGCTCTCTGTGTACCTAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053162155_1053162158 6 Left 1053162155 9:35820586-35820608 CCTCTGTGTTCCTGGTGCTATTG 0: 1
1: 2
2: 2
3: 25
4: 258
Right 1053162158 9:35820615-35820637 TGCTCTCTGTGTACCTAAGAAGG No data
1053162156_1053162158 -4 Left 1053162156 9:35820596-35820618 CCTGGTGCTATTGTACCAATGCT 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1053162158 9:35820615-35820637 TGCTCTCTGTGTACCTAAGAAGG No data
1053162150_1053162158 29 Left 1053162150 9:35820563-35820585 CCACGTTGGTACCTTAATACCTC 0: 1
1: 0
2: 0
3: 1
4: 25
Right 1053162158 9:35820615-35820637 TGCTCTCTGTGTACCTAAGAAGG No data
1053162151_1053162158 18 Left 1053162151 9:35820574-35820596 CCTTAATACCTCCCTCTGTGTTC 0: 1
1: 0
2: 0
3: 11
4: 212
Right 1053162158 9:35820615-35820637 TGCTCTCTGTGTACCTAAGAAGG No data
1053162154_1053162158 7 Left 1053162154 9:35820585-35820607 CCCTCTGTGTTCCTGGTGCTATT 0: 1
1: 1
2: 3
3: 44
4: 383
Right 1053162158 9:35820615-35820637 TGCTCTCTGTGTACCTAAGAAGG No data
1053162153_1053162158 10 Left 1053162153 9:35820582-35820604 CCTCCCTCTGTGTTCCTGGTGCT 0: 1
1: 0
2: 2
3: 41
4: 473
Right 1053162158 9:35820615-35820637 TGCTCTCTGTGTACCTAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053162158 Original CRISPR TGCTCTCTGTGTACCTAAGA AGG Intronic
No off target data available for this crispr