ID: 1053162583 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:35823950-35823972 |
Sequence | GCAAATTCTGGCTGGCAAGG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1053162583_1053162589 | 28 | Left | 1053162583 | 9:35823950-35823972 | CCACCTTGCCAGCCAGAATTTGC | No data | ||
Right | 1053162589 | 9:35824001-35824023 | ACATAAGCAAACAAAGTTGGTGG | No data | ||||
1053162583_1053162588 | 25 | Left | 1053162583 | 9:35823950-35823972 | CCACCTTGCCAGCCAGAATTTGC | No data | ||
Right | 1053162588 | 9:35823998-35824020 | TTAACATAAGCAAACAAAGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1053162583 | Original CRISPR | GCAAATTCTGGCTGGCAAGG TGG (reversed) | Intronic | ||