ID: 1053162583

View in Genome Browser
Species Human (GRCh38)
Location 9:35823950-35823972
Sequence GCAAATTCTGGCTGGCAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053162583_1053162589 28 Left 1053162583 9:35823950-35823972 CCACCTTGCCAGCCAGAATTTGC No data
Right 1053162589 9:35824001-35824023 ACATAAGCAAACAAAGTTGGTGG No data
1053162583_1053162588 25 Left 1053162583 9:35823950-35823972 CCACCTTGCCAGCCAGAATTTGC No data
Right 1053162588 9:35823998-35824020 TTAACATAAGCAAACAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053162583 Original CRISPR GCAAATTCTGGCTGGCAAGG TGG (reversed) Intronic