ID: 1053162588

View in Genome Browser
Species Human (GRCh38)
Location 9:35823998-35824020
Sequence TTAACATAAGCAAACAAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053162583_1053162588 25 Left 1053162583 9:35823950-35823972 CCACCTTGCCAGCCAGAATTTGC No data
Right 1053162588 9:35823998-35824020 TTAACATAAGCAAACAAAGTTGG No data
1053162586_1053162588 13 Left 1053162586 9:35823962-35823984 CCAGAATTTGCAAGAAAATAAGA No data
Right 1053162588 9:35823998-35824020 TTAACATAAGCAAACAAAGTTGG No data
1053162584_1053162588 22 Left 1053162584 9:35823953-35823975 CCTTGCCAGCCAGAATTTGCAAG No data
Right 1053162588 9:35823998-35824020 TTAACATAAGCAAACAAAGTTGG No data
1053162585_1053162588 17 Left 1053162585 9:35823958-35823980 CCAGCCAGAATTTGCAAGAAAAT No data
Right 1053162588 9:35823998-35824020 TTAACATAAGCAAACAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053162588 Original CRISPR TTAACATAAGCAAACAAAGT TGG Intronic