ID: 1053163472

View in Genome Browser
Species Human (GRCh38)
Location 9:35829254-35829276
Sequence CCGCGGGGCCTGGTTATCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 42}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053163462_1053163472 20 Left 1053163462 9:35829211-35829233 CCGGGGGGCGGGGCGTCACGCCG 0: 1
1: 0
2: 0
3: 9
4: 125
Right 1053163472 9:35829254-35829276 CCGCGGGGCCTGGTTATCGCCGG 0: 1
1: 0
2: 0
3: 4
4: 42
1053163461_1053163472 24 Left 1053163461 9:35829207-35829229 CCGGCCGGGGGGCGGGGCGTCAC 0: 1
1: 0
2: 0
3: 18
4: 173
Right 1053163472 9:35829254-35829276 CCGCGGGGCCTGGTTATCGCCGG 0: 1
1: 0
2: 0
3: 4
4: 42
1053163464_1053163472 0 Left 1053163464 9:35829231-35829253 CCGACGTCAAGTCGAGGCCGCCG 0: 1
1: 0
2: 0
3: 1
4: 12
Right 1053163472 9:35829254-35829276 CCGCGGGGCCTGGTTATCGCCGG 0: 1
1: 0
2: 0
3: 4
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053163472 Original CRISPR CCGCGGGGCCTGGTTATCGC CGG Intronic
904433025 1:30477266-30477288 GAGTGAGGCCTGGTTATCGCAGG + Intergenic
905731996 1:40304071-40304093 CCGCGGGGCCCGGTCTTCCCTGG + Exonic
912447677 1:109750353-109750375 CAGCGGGGCCTGGTTCTTGGAGG + Exonic
912532744 1:110338471-110338493 CCGCGGGCCCAGGTGACCGCGGG + Intergenic
912985482 1:114424631-114424653 CCGCTGTGCCTGGGTATCCCTGG + Exonic
917962346 1:180154981-180155003 CCGCGGGGCCGCGTTAGCGCCGG - Exonic
924954673 1:248914830-248914852 CTGTGGGGCCTGGTTCTCTCTGG + Intronic
1084328029 11:68412988-68413010 CCCCGTGTCCTGGTTGTCGCTGG + Intronic
1089673480 11:120073242-120073264 CCCCGGGGCCTGATTGTCCCTGG + Intergenic
1096558412 12:52418482-52418504 CAGAGGGGGCTGGTTATCCCTGG - Intergenic
1107762456 13:43695136-43695158 CTGCGGGGCCTGGTGACTGCAGG - Intronic
1126099067 15:45108849-45108871 CAGCAGGGCCTGGCTATAGCTGG + Exonic
1135142597 16:19934635-19934657 CCTCAGGGCCTGGTTATGGTGGG + Intergenic
1136066906 16:27765464-27765486 CCGCATGGCCTGGATATCCCAGG - Intronic
1140478706 16:75251358-75251380 CTGCGGGGCCTGGGAACCGCCGG - Intronic
1141468566 16:84222951-84222973 CTGCGTGGCCTGGTTCTCCCTGG - Exonic
1146160383 17:30556368-30556390 CCTCGGGCTCTGGTTCTCGCTGG + Intergenic
1154268134 18:12896820-12896842 CCGCGCGGCCTAGTTCTCGGGGG - Intronic
932313896 2:70767412-70767434 CCCCGGGGCCTCGCGATCGCTGG - Intronic
933911292 2:86942961-86942983 CCGCGCGGCCTAGTTCTCGGGGG + Intronic
935775065 2:106466081-106466103 CCGCGCGGCCTAGTTCTCGGGGG - Intronic
935905004 2:107829815-107829837 CCGCGCAGCCTGGTTCTCGGGGG + Intronic
935991166 2:108719995-108720017 CCGCGCGGCCTAGTTCTCGGGGG + Intronic
936126782 2:109794898-109794920 CCGCGCGGCCTAGTTCTCGGGGG + Intronic
936217915 2:110576588-110576610 CCGCGCGGCCTAGTTCTCGGGGG - Intronic
936427257 2:112432686-112432708 CCGCGCGGCCTAGTTCTCGGGGG - Intronic
1168830820 20:844493-844515 CAGCTGGGCCTGGTTCTCCCGGG + Intronic
1169135608 20:3195312-3195334 CCGCTGGGCCTGCTCCTCGCGGG + Exonic
1170852488 20:20017562-20017584 CGGCGGGGGGTGGTTCTCGCGGG - Intronic
1171391917 20:24807112-24807134 CCGTGGGGCCTGGGCATCGTTGG - Intergenic
1171974859 20:31587917-31587939 CCGCCGGGCCTGGTTCCCACGGG + Intergenic
1172109330 20:32536269-32536291 CCGCGGGGCCTGGCTGGCTCAGG - Intronic
1176088957 20:63310489-63310511 CTGCGGGGCCTGGTGACCACAGG + Exonic
1184019169 22:41809066-41809088 CAGCTGGGCCTGCTTATCCCTGG - Intronic
971195809 4:24471193-24471215 CCGCGGGGCCCGGGAATCCCCGG + Intergenic
986566655 5:9122709-9122731 CTGCGGGGCCGGGCTGTCGCAGG + Exonic
999727044 5:154446099-154446121 CCGCGGGGCCCGGGTGCCGCGGG + Exonic
1007656593 6:43454815-43454837 CCGCTGGGCATGGTCAGCGCCGG + Exonic
1019258073 7:64315-64337 CCTGGGGGCCTGATTATCGCAGG + Intergenic
1035028654 7:155843646-155843668 CCGCGGGGCCTGGTGTCTGCGGG + Intergenic
1035737479 8:1898836-1898858 CCGCGGGGCTTGGTTATCAGTGG + Intronic
1041792656 8:61714380-61714402 CCGCGGGGGCTGGTGAGGGCTGG + Exonic
1048716987 8:137281861-137281883 CCCCGGGGCCTGGTTAACAAGGG + Intergenic
1052901602 9:33798653-33798675 CGGTGGGGCCTGGGTATCGGTGG - Intronic
1053163472 9:35829254-35829276 CCGCGGGGCCTGGTTATCGCCGG + Intronic
1062016550 9:134294049-134294071 CCGCGGGGCCTGGTCCTGGCTGG + Intergenic
1062560470 9:137139385-137139407 CCGCGGGGCCGGGCGAGCGCAGG + Intronic