ID: 1053164080

View in Genome Browser
Species Human (GRCh38)
Location 9:35832492-35832514
Sequence AGCCATCCCCACAGTGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 277}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053164080_1053164083 1 Left 1053164080 9:35832492-35832514 CCCTGGCCACTGTGGGGATGGCT 0: 1
1: 0
2: 3
3: 20
4: 277
Right 1053164083 9:35832516-35832538 AGCTAGTTCCCCAGTTCCCCAGG No data
1053164080_1053164091 29 Left 1053164080 9:35832492-35832514 CCCTGGCCACTGTGGGGATGGCT 0: 1
1: 0
2: 3
3: 20
4: 277
Right 1053164091 9:35832544-35832566 CTGTGATCCTTTGAATTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053164080 Original CRISPR AGCCATCCCCACAGTGGCCA GGG (reversed) Intronic
900218761 1:1495929-1495951 ACCCACCCTCACAGTGGCCTGGG - Exonic
900226118 1:1534370-1534392 ACCCACCCTCACAGTGGCCTGGG - Exonic
900645151 1:3705651-3705673 AGCCATCACCACTGTTCCCAGGG - Intronic
900689770 1:3973559-3973581 ACCCTTCCCCACAGTGTCTAGGG + Intergenic
900689794 1:3973647-3973669 ACCCTTCCCCACAGTGTCTAGGG + Intergenic
900979195 1:6036653-6036675 AACCGGCCCCACAGTGTCCATGG - Intronic
901037371 1:6344357-6344379 AGCCTTCCCCACAGTGCCACGGG + Intronic
902412749 1:16220993-16221015 AGCCATCCTCACTGTGGTGAGGG - Intergenic
903657535 1:24958568-24958590 TCCCATCCCCACTGTGTCCAGGG + Intronic
903779550 1:25812639-25812661 AGCCATCATCAAAGCGGCCAGGG - Intronic
905539033 1:38745552-38745574 AGGCATGTCCACAGTGGTCATGG - Intergenic
906215076 1:44033894-44033916 TGCCCGCCCCACAGTGGCCCAGG - Intergenic
907084988 1:51663434-51663456 AGCCATCCCCAAAGGGGCAGAGG - Intronic
907415539 1:54311587-54311609 AGCCAGCCCCACAGCCCCCAAGG + Intronic
911883686 1:103271308-103271330 ACCCATGAACACAGTGGCCATGG + Intergenic
916720599 1:167482424-167482446 CCCCACCCCCACAGAGGCCAGGG - Intronic
917200693 1:172511257-172511279 AGCCATCCCCAAAGCAGGCAAGG - Intergenic
917484886 1:175447100-175447122 AACCATCCCCACACTGCCCCCGG + Intronic
919205267 1:194414200-194414222 AGGCATATCCACAGTGACCATGG - Intergenic
919430583 1:197486862-197486884 CCCCATCCCCACAGTGGCCGTGG + Intergenic
920351097 1:205338587-205338609 AGCCATCCCCCTATAGGCCATGG + Exonic
920421879 1:205840296-205840318 TGTCATCCCCCCAGTGGCCCAGG - Exonic
921162528 1:212483293-212483315 AGCCCTGCCCACAGTCTCCACGG - Intergenic
921203617 1:212829423-212829445 GTCCATCCCCACAGTGGTGATGG - Intergenic
921507028 1:215984109-215984131 AACCTTCCTCACAGTGGCAATGG - Intronic
922083883 1:222326362-222326384 AGCCATCCCCAAAATAACCAAGG - Intergenic
923687088 1:236160852-236160874 AGCAGTCCCCTCAGTGGTCAAGG - Intronic
1062829772 10:597907-597929 GGCCATGCCCCCAGGGGCCAAGG + Intronic
1062832529 10:615359-615381 AGCCACCCGCATAGGGGCCACGG + Intronic
1064350327 10:14570368-14570390 AGTCATTCTCACAGTGGCTATGG - Intronic
1064516587 10:16155845-16155867 AGCCAGACCAACAGTGGACAGGG + Intergenic
1066357179 10:34695892-34695914 ATCCATCCCAACCGTGGCCTTGG - Intronic
1069181181 10:65360953-65360975 TGCCAACCCCACAGTGGTGACGG - Intergenic
1069703451 10:70442163-70442185 GGCCATCTAGACAGTGGCCAGGG - Intronic
1069838945 10:71327264-71327286 AGCCATCCCCACATTTGTCCAGG - Intronic
1070820012 10:79348979-79349001 ACCCACCCCCACAGTGGCCAAGG - Intronic
1071363840 10:84878599-84878621 AGCCATCCTGACTGTGGCCTGGG + Intergenic
1075643335 10:124081023-124081045 TCTCATCCCCACAGTGGCCCAGG - Intronic
1075718933 10:124573953-124573975 AGCCACCCCCACAGCCTCCAGGG + Intronic
1075721739 10:124591385-124591407 AGCCTGCCCCACACTGTCCATGG - Intronic
1075726349 10:124612830-124612852 AGCTGTCCCCACAGTGCACATGG + Intronic
1076688602 10:132209323-132209345 AGCCATCCACCCAGAGGCAAGGG - Intronic
1076705125 10:132297259-132297281 GGCCATCCCCAGCGTGTCCAGGG + Intronic
1076808816 10:132876105-132876127 GGCCAACCTCACTGTGGCCAGGG + Intronic
1076880453 10:133237067-133237089 GGCTGTCCCCACTGTGGCCAGGG - Intergenic
1076935544 10:133566090-133566112 CTCCATGCCCACAGTGGCCGAGG + Intronic
1077111016 11:862304-862326 AGCCTCCCCGACTGTGGCCATGG + Intronic
1077154411 11:1084993-1085015 TCCCATCCCCAGGGTGGCCAGGG - Intergenic
1078425097 11:11243453-11243475 CCACATCCCCACAGTGGCCCCGG - Intergenic
1084416101 11:69033751-69033773 GGCCAACCCCACAGTTGCCCTGG - Intergenic
1084971045 11:72772215-72772237 AGCCATGCCCACTATGGCTATGG - Intronic
1084971072 11:72772326-72772348 TGCCATAGCCACAGTGGGCACGG + Intronic
1085315948 11:75545038-75545060 AGCCATTCCCAGGGTGGCCCTGG - Intergenic
1085387885 11:76167637-76167659 AGCCCTCACCACTGTGACCACGG + Intergenic
1087825327 11:102758250-102758272 AGCCATCCCCTCAGTGCTCCTGG + Intergenic
1088193112 11:107247936-107247958 AGGAATTCACACAGTGGCCAGGG + Intergenic
1090390811 11:126386161-126386183 TTCTATCCCCCCAGTGGCCAAGG + Intronic
1090915683 11:131160260-131160282 AGGCATTGTCACAGTGGCCATGG + Intergenic
1090962860 11:131572667-131572689 AGACATCCCCACAGAGGCTCTGG + Intronic
1091832781 12:3561867-3561889 TGCGATCCCCACAATGGCCCTGG - Intronic
1092209320 12:6636065-6636087 ACCCAACCCCACACGGGCCAAGG + Exonic
1095864506 12:46956807-46956829 AGGCCTGCCAACAGTGGCCATGG + Intergenic
1097068742 12:56339470-56339492 AGCCATCTCCACACTGGATATGG - Exonic
1097584894 12:61503577-61503599 AACCATCCCCGCATTGTCCATGG + Intergenic
1099133470 12:78864545-78864567 CTCCATCCCCACAGCGGACAGGG - Intronic
1101802952 12:108038280-108038302 AGCCTTTCTCACAGTGCCCAGGG - Intergenic
1102414764 12:112750991-112751013 AGCCAGCACCACAGAAGCCAGGG + Intronic
1102490931 12:113289096-113289118 GGCCACCCCCACAGTAGCCTGGG + Intronic
1103021699 12:117539744-117539766 ACCCTTCCCCACAGTGCACACGG - Exonic
1103590705 12:121990243-121990265 TGCCATGCACACAGTGGCCAGGG - Intronic
1104015660 12:124960101-124960123 AGCCATCCCCTGGGTGTCCACGG + Intronic
1105700515 13:22932775-22932797 CGCTGTCCCCACAGTGGGCACGG - Intergenic
1105853285 13:24354824-24354846 CGCTGTCCCCACAGTGGGCACGG - Intergenic
1105955866 13:25282166-25282188 AGCCATCCCCACATGGGGGATGG - Intronic
1113891046 13:113735822-113735844 AGCCCTCCCCAGTGGGGCCAGGG - Exonic
1117193422 14:53316385-53316407 CCCAACCCCCACAGTGGCCATGG - Intergenic
1118332649 14:64825871-64825893 TGCCATCCCTCCTGTGGCCATGG + Intronic
1119114123 14:72002623-72002645 AGCCATCCCCAAGGAGCCCAGGG - Intronic
1119646334 14:76351110-76351132 CTCCAGCCCCACAGTGGCCAGGG - Intronic
1122159044 14:99769456-99769478 GGCCTCCCCCACAGTGGGCAGGG + Intronic
1122232533 14:100313877-100313899 AGCCATACCCACTGTGACAATGG - Intergenic
1122745919 14:103897179-103897201 AACCACTCCCACGGTGGCCACGG + Intergenic
1122999861 14:105287522-105287544 TGCCTTCCCCCAAGTGGCCAAGG - Intronic
1124680038 15:31722828-31722850 AGCAATACACACAGAGGCCATGG + Intronic
1125715646 15:41818440-41818462 CTCCATCCCAACAGTGGACACGG - Intronic
1125725837 15:41867713-41867735 TGCCATACCCAGAGTGCCCATGG - Intronic
1126480216 15:49110776-49110798 TGCCATCCCCACAGGGGCCTGGG + Intronic
1127284711 15:57522247-57522269 AGCCAGCCCAACAGAGCCCAGGG + Intronic
1127377853 15:58401669-58401691 AGCCCTGCTCACAGTGGCCATGG + Intronic
1127865313 15:63027933-63027955 AGCCAACTCCACAGGTGCCATGG + Intergenic
1128687796 15:69699703-69699725 AGCCGACCCCACCGTGGCCTGGG + Intergenic
1129465953 15:75724323-75724345 AGCCATCCCCACCCTGGGCTTGG + Intronic
1129742632 15:77997164-77997186 GGCCATCCCCAAGGAGGCCATGG + Exonic
1129842841 15:78754282-78754304 GGCCATCCCCAAGGAGGCCATGG - Intergenic
1132765833 16:1533764-1533786 AGGCATCCACACAGGGGCCCAGG + Exonic
1133107136 16:3519299-3519321 AGCAGTTCCCACAGTGGCAATGG - Intronic
1134784012 16:16924473-16924495 AGCCTTCCCCAAAGGGACCAAGG - Intergenic
1135619723 16:23945360-23945382 AGACATCCCAACAGTGGCAGGGG - Intronic
1136365515 16:29807412-29807434 AGCCATCCACACGGGAGCCAAGG + Exonic
1136556908 16:31012271-31012293 AGCCATGCCCACTGTAGTCATGG - Intergenic
1137070165 16:35898106-35898128 AGCCATCCGCACAGCTGCCCTGG - Intergenic
1139547322 16:67655691-67655713 AGCCATCCCTGCAGTGCCCATGG + Intronic
1139654281 16:68377894-68377916 AGGCTTCCTCACAGGGGCCAGGG - Intronic
1140069172 16:71634400-71634422 GGCCATTGCCACAGTGACCATGG - Intronic
1141556259 16:84838642-84838664 AGCCATCCCCAGGGAGGACAAGG + Exonic
1142010694 16:87712338-87712360 AGCCACGCCCACACTGGGCATGG - Intronic
1144468324 17:15515097-15515119 GCCCATACCCACAGTGGGCATGG + Intronic
1144786551 17:17835516-17835538 TGCCAACCCCAGGGTGGCCACGG + Intronic
1147313739 17:39608985-39609007 AGTAATCCCAAGAGTGGCCAAGG + Intronic
1148508278 17:48145929-48145951 ATCCATCCACAGAGAGGCCAGGG - Intronic
1151554043 17:74837669-74837691 ATCCAACCCCACATTGCCCAAGG - Exonic
1152920919 17:83066234-83066256 GGCCAACCCGAAAGTGGCCAGGG - Intergenic
1154391091 18:13936829-13936851 AGCCTTCACCACAGTGCCCTTGG - Intergenic
1156543992 18:37945599-37945621 AGACATGGCTACAGTGGCCAGGG + Intergenic
1157389785 18:47292050-47292072 TGCTATTCCCACTGTGGCCAAGG + Intergenic
1158329687 18:56347872-56347894 AGCCATCCTCAAAGTGGCACTGG - Intergenic
1160429973 18:78804461-78804483 GGCCATCCCAACAGTGCCCTGGG + Intergenic
1160435328 18:78847674-78847696 TGCCCTCGCCACTGTGGCCATGG - Intergenic
1160902750 19:1436891-1436913 AGCCGTCCCCACAGTCCCAAGGG - Intergenic
1161486235 19:4537333-4537355 AGGCAGCCCCAGTGTGGCCAGGG + Exonic
1162461993 19:10818775-10818797 AGTCCTCCCCACAGTGCCCCTGG - Intronic
1162500841 19:11052743-11052765 AGCCCTGCAGACAGTGGCCATGG + Intronic
1163738097 19:18994143-18994165 AGCAAACCTCACACTGGCCAAGG - Exonic
1164639633 19:29814437-29814459 AGCTATCCACACTGTGGCCAGGG - Intronic
1165369515 19:35395792-35395814 AGCCACCCTCACAGTGACCCTGG - Intergenic
1166305960 19:41937225-41937247 AGCCACCCCACCAGTGCCCATGG + Intergenic
1166966801 19:46533897-46533919 TGCCATCCCCACAGAGGTCCTGG + Intronic
1167386291 19:49166074-49166096 CGCCCACCCCGCAGTGGCCATGG + Exonic
1168291121 19:55358252-55358274 AGACGACCCCACAGTGGCCAGGG + Exonic
925148598 2:1599743-1599765 AGCCGTCTTCACAGTGGCCTGGG + Intergenic
925542006 2:4976607-4976629 GGCCATCCCCATGGTGGCCTGGG + Intergenic
927519254 2:23689260-23689282 AGCCATGCCTCCTGTGGCCAGGG + Intronic
927694290 2:25229904-25229926 AGGCTTCCCCAGAGTCGCCATGG + Exonic
928891163 2:36204855-36204877 ATCCTGCACCACAGTGGCCAAGG - Intergenic
929581183 2:43082596-43082618 ATCCATCCCCCCAGGGCCCAGGG + Intergenic
929994136 2:46814603-46814625 TTCCATCACCACACTGGCCATGG - Intergenic
932345538 2:70993050-70993072 AGCCATGCCCAGAGTGCACATGG + Intronic
934635475 2:95984220-95984242 AGTCATCCCTACAGAGGCAAGGG + Intronic
934798156 2:97121032-97121054 AGTCATCCCTACAGAGGCAAGGG - Intronic
934835268 2:97582406-97582428 AGTCATCCCTACAGAGGCAAGGG + Intronic
935373042 2:102367309-102367331 AACCATCCCCACACTTACCAGGG + Intronic
936076304 2:109403888-109403910 CTCCACCCTCACAGTGGCCATGG - Intronic
936617385 2:114061853-114061875 AGCCAACCACGCAGTGGACATGG - Intergenic
938081258 2:128371359-128371381 AGCCATCCCTGGAGGGGCCACGG - Intergenic
939624190 2:144456730-144456752 AGTCATCCGTACAGTGGCCAGGG + Intronic
939862374 2:147435642-147435664 GGCCAGCCCCACAGTGACCTGGG + Intergenic
942781907 2:179653842-179653864 TGCCTTCCCCACACTAGCCAAGG + Intronic
944913515 2:204333692-204333714 AGCCCTGGCCACAGAGGCCATGG - Intergenic
945065729 2:205946352-205946374 AGCCATCCCCACTGCAGTCAGGG - Intergenic
948693590 2:239721700-239721722 AGCCACCCCCACATTGGGCTGGG + Intergenic
1170571820 20:17636960-17636982 TGCCACCTCCACTGTGGCCAAGG - Intronic
1171516302 20:25740673-25740695 AGCCATCCCAATGGTGACCAAGG + Intergenic
1172096588 20:32463488-32463510 GGCCCTCCCCACTGTGGCAAAGG + Intronic
1172596695 20:36155018-36155040 ACCCTCCCCCACACTGGCCAGGG - Intronic
1172897787 20:38312649-38312671 AGTCATTCCCACAGTGGACAGGG - Intronic
1174222973 20:48972148-48972170 AGCCGTCCCCACCAAGGCCAGGG + Intronic
1175395537 20:58657040-58657062 AGCCAACACCAGAGTGGCCCAGG - Intronic
1175476567 20:59279195-59279217 AGCCAGCCACTCAGTGGCCGCGG - Intergenic
1175776788 20:61658782-61658804 AGCAACACCCACAGTGGACATGG + Intronic
1175825464 20:61934296-61934318 AGCCATCTCCACAGTGCCGGCGG + Intronic
1176074651 20:63242921-63242943 GGCCATCCCCACATAGGCCGAGG - Intronic
1176076249 20:63249657-63249679 ATTCATCCCCTCAGTAGCCAGGG - Intronic
1176151861 20:63595561-63595583 ACCCAGCCCCACCCTGGCCATGG - Intronic
1180059576 21:45377826-45377848 CCCCAGCCCCACAGTGCCCAGGG + Intergenic
1180064753 21:45406586-45406608 CTCCATCCCCACAGCGGCCCAGG + Intronic
1180230163 21:46422273-46422295 AGGCAGCCCCACGGTGGCCCCGG + Intronic
1180244034 21:46534411-46534433 AAGCATCCCCTCAGCGGCCAGGG + Intronic
1181529045 22:23505738-23505760 AGCCCTGCACACAGTGGACATGG + Intergenic
1182075125 22:27490332-27490354 AGCCATCCTGACAGAGGTCATGG + Intergenic
1182391854 22:30004338-30004360 AGCAAGCCCCACAGATGCCAGGG - Intronic
1183685870 22:39361123-39361145 AGTCATCCCCACAGAGCCCAAGG - Intronic
1183986145 22:41571764-41571786 AGCCCTCCTCACTGTGGCCAGGG + Intronic
1184197427 22:42939548-42939570 AGCCAACCCCACAGAGGGAATGG + Intronic
1184231277 22:43159600-43159622 ACCCATCCCCCCAGGGGCCCAGG - Intronic
1184300433 22:43555678-43555700 TGACCTCCCCACAGTGGGCACGG + Intronic
1184753647 22:46503455-46503477 AGCCGTCCCCACTGTGACCACGG + Intronic
1184893788 22:47395241-47395263 AGCCATCCTCGCCGTGGCCCTGG - Intergenic
1185153914 22:49182028-49182050 AGCCATCGGCAGAGGGGCCATGG - Intergenic
950899281 3:16482790-16482812 AGGGATCCCCAGAGAGGCCAGGG + Intronic
952884890 3:38006271-38006293 AGCCTTCCCCACAGTGGCCTGGG + Intronic
952900515 3:38109034-38109056 GGCCATCCCCATATTTGCCAGGG - Intronic
953232626 3:41078049-41078071 AGCGGTCCCCACAGTGGGCCTGG + Intergenic
954639261 3:52088426-52088448 CATCATGCCCACAGTGGCCATGG - Intronic
954878115 3:53816590-53816612 AGCCATCCCAGCAGTGGACAAGG - Exonic
955201656 3:56857203-56857225 AGCCACATCTACAGTGGCCACGG + Intronic
960366360 3:116777564-116777586 GGCAGTCCCCACAGTGGCCCAGG + Intronic
961663029 3:128480471-128480493 AGCCAAAGCCAGAGTGGCCACGG - Exonic
961667056 3:128498996-128499018 AGCCCTCCCTAGAGAGGCCACGG - Intergenic
963639698 3:147843461-147843483 ACCCATCCCAAGAGTGGCTAAGG + Intergenic
966023710 3:175248692-175248714 ATACATTCACACAGTGGCCACGG - Intronic
966120002 3:176510682-176510704 AGCCATTGCCTCAGTGGCAATGG - Intergenic
966554663 3:181245363-181245385 CCCCATCCCCACACTGGCCCCGG - Intergenic
968636938 4:1685392-1685414 ACCGAGCCCCACGGTGGCCAGGG - Intergenic
970366151 4:15360146-15360168 AGCCATCCTCTGAGTAGCCAGGG + Intronic
972177349 4:36424163-36424185 ATCCATCCCCACAGTGAAGAAGG + Intergenic
972795475 4:42413465-42413487 AGCCATTCCCACAGATACCAAGG - Intronic
974456158 4:62131246-62131268 AGGCATTCTCACAGTGGCAAGGG - Intergenic
974894822 4:67926646-67926668 CGCCCTCCCTGCAGTGGCCATGG - Intronic
975319912 4:72998107-72998129 AGTCATCCCCACAGTATCTATGG + Intergenic
975623225 4:76315233-76315255 TGCGTACCCCACAGTGGCCACGG + Intronic
975632575 4:76417791-76417813 GGTCAGCCTCACAGTGGCCAGGG + Intronic
978585362 4:110270921-110270943 ATCCATCACCACAGTGGCTGGGG - Intergenic
981049152 4:140293791-140293813 TTCCATCACCATAGTGGCCATGG - Intronic
984751901 4:183286212-183286234 CCCCATCTCCATAGTGGCCATGG - Intronic
985766103 5:1780276-1780298 CACCATCCCCACAGGAGCCAGGG - Intergenic
986284120 5:6347461-6347483 AGACACTCACACAGTGGCCAAGG + Intergenic
986307345 5:6525523-6525545 CGGCGTCCCCACAGTGACCAGGG - Intergenic
986637226 5:9835280-9835302 AGCTCTCTCCACTGTGGCCAGGG + Intergenic
987149195 5:15021645-15021667 ACCCATCCTCACTGTGGCAAGGG - Intergenic
989949375 5:50279681-50279703 TGCCAGCCCCACAGAGACCACGG + Intergenic
990448393 5:55914074-55914096 TTTCTTCCCCACAGTGGCCAGGG - Intronic
994590786 5:101769254-101769276 AGCCATCCTAAAAGGGGCCAAGG - Intergenic
995712918 5:115052927-115052949 AGCCAACCGCACACTGGCCAGGG - Intergenic
995748700 5:115431030-115431052 AGCCAGGCCAGCAGTGGCCACGG - Intergenic
998470862 5:142382712-142382734 AACCAAGCCCACAGTGTCCAAGG - Intergenic
1000464854 5:161563240-161563262 AGCCTTCACCACAGTGGAAAAGG - Intronic
1001182611 5:169534639-169534661 AGGCCACCCCACAGTGGCCTAGG - Intergenic
1001237442 5:170042164-170042186 AACCATCCTTCCAGTGGCCAGGG - Intronic
1001881334 5:175246758-175246780 AGCCATGACCACAGAGCCCATGG - Intergenic
1002274411 5:178095145-178095167 AGCCATCTGAAGAGTGGCCACGG - Intergenic
1002274420 5:178095188-178095210 AGCCATCTGAAGAGTGGCCACGG - Intergenic
1002274429 5:178095231-178095253 AGCCATCTGAAGAGTGGCCACGG - Intergenic
1002274461 5:178095403-178095425 AGCCATCTGAAGAGTGGCCACGG - Intergenic
1002274486 5:178095532-178095554 AGCCATCTGAAGAGTGGCCACGG - Intergenic
1002274512 5:178095661-178095683 AGCCATCTGAAGAGTGGCCACGG - Intergenic
1002274521 5:178095704-178095726 AGCCATCTGAAGAGTGGCCACGG - Intergenic
1002274530 5:178095747-178095769 AGCCATCTGAAGAGTGGCCACGG - Intergenic
1002274539 5:178095790-178095812 AGCCATCTGAAGAGTGGCCACGG - Intergenic
1002274556 5:178095876-178095898 AGCCATCTGAAGAGTGGCCACGG - Intergenic
1002274565 5:178095919-178095941 AGCCATCTGAAGAGTGGCCACGG - Intergenic
1002274582 5:178096005-178096027 AGCCATCTGAAGAGTGGCCACGG - Intergenic
1002274608 5:178096134-178096156 AGCCATCTGAAGAGTGGCCACGG - Intergenic
1002274617 5:178096177-178096199 AGCCATCTGAAGAGTGGCCACGG - Intergenic
1002274635 5:178096263-178096285 AGCCATCTGAAGAGTGGCCACGG - Intergenic
1002274644 5:178096306-178096328 AGCCATCTGAAGAGTGGCCACGG - Intergenic
1002274662 5:178096392-178096414 AGCCATCTGAAGAGTGGCCACGG - Intergenic
1002274680 5:178096478-178096500 AGCCATCTGAAGAGTGGCCACGG - Intergenic
1002274698 5:178096564-178096586 AGCCATCTGAAGAGTGGCCACGG - Intergenic
1002274707 5:178096607-178096629 AGCCATCTGAAGAGTGGCCACGG - Intergenic
1002274742 5:178096779-178096801 AGCCATCTGAAGAGTGGCCACGG - Intergenic
1002274769 5:178096908-178096930 AGCCATCTGAAGAGTGGCCACGG - Intergenic
1002274778 5:178096951-178096973 AGCCATCTGAAGAGTGGCCACGG - Intergenic
1002274787 5:178096994-178097016 AGCCATCTGAAGAGTGGCCACGG - Intergenic
1002274795 5:178097037-178097059 AGCCATCTGAAGAGTGGCCACGG - Intergenic
1002879546 6:1238745-1238767 AACCATCCCCACAGTCCCCCTGG + Intergenic
1003420627 6:5954911-5954933 AGTTATTCACACAGTGGCCATGG + Intergenic
1010806919 6:80248200-80248222 AGTCAGCACCACAGTGTCCAAGG + Intronic
1010916124 6:81621343-81621365 AGCCATCCCCACTGTGTTCCAGG - Intronic
1016017901 6:139204930-139204952 CCCCATCCCCACAGTGGCTGTGG + Intergenic
1017403525 6:154091906-154091928 ATCCATGACCACAGTGGGCAAGG - Intronic
1018426551 6:163688043-163688065 ATCCTTCCCCACAGTGGACTGGG + Intergenic
1018810231 6:167293584-167293606 AGCCAACCCCATAGTAGCCTTGG - Intronic
1019161197 6:170067934-170067956 GGCCTTTGCCACAGTGGCCAGGG - Intergenic
1019366671 7:636653-636675 TGCTGTCCTCACAGTGGCCACGG - Intronic
1019430328 7:996172-996194 AGCCAGGCCAGCAGTGGCCACGG + Intergenic
1020076611 7:5262829-5262851 AATCTTCCCCACAGTTGCCAGGG + Intergenic
1021292517 7:18863900-18863922 AGCAGTACTCACAGTGGCCATGG - Intronic
1023512477 7:40968349-40968371 AGCCCTCCTCACAGTGGACTCGG - Intergenic
1024446282 7:49483496-49483518 AGCCATCTCCACTGTGGGGAAGG + Intergenic
1024446283 7:49483498-49483520 AACCTTCCCCACAGTGGAGATGG - Intergenic
1024889666 7:54185595-54185617 AGCCACAGCCACAGTGGCAAAGG + Intergenic
1025248807 7:57337966-57337988 AGACTGTCCCACAGTGGCCAAGG + Intergenic
1026445916 7:70484587-70484609 ATTCATCCCCACAGTGGCACTGG - Intronic
1028197127 7:87920234-87920256 CCCCATCCCCACAGTGGCCATGG + Intergenic
1029528906 7:101112361-101112383 AGTCATCCCCACGGGGGCAAGGG - Intergenic
1029648724 7:101875678-101875700 GCCCCTCCCCACAGTGCCCACGG + Intronic
1033224286 7:139548394-139548416 ACCCATCCCCACAGGGACCTCGG + Intergenic
1034267622 7:149788887-149788909 AGCCATCGCCACAGTCGTCCTGG - Intergenic
1034461522 7:151200281-151200303 TTCCAGCCCCACAGTGCCCACGG - Intronic
1035202471 7:157276319-157276341 TGCCTGCCCCGCAGTGGCCAGGG - Intergenic
1037043260 8:14264195-14264217 AGCCATTCCCACAGTCACCATGG - Intronic
1041205674 8:55495625-55495647 GGCCCTCCCCACAGTGGCGGTGG + Intronic
1042004588 8:64167369-64167391 AGCCATCACCATAGTGCCAAGGG - Intergenic
1042011185 8:64246371-64246393 AACAATCCCCACAGTGTCAAGGG - Intergenic
1044967068 8:97584110-97584132 TCCCATCCCCACAGAGGCCAGGG - Intergenic
1049245425 8:141559857-141559879 AGCCATGCTCACACTTGCCAGGG - Intergenic
1049283473 8:141762287-141762309 CCCCAGCCCCACAGTGACCAGGG - Intergenic
1049808747 8:144553744-144553766 TGCCATCACCACACTGGCCAAGG + Intronic
1052039155 9:23718621-23718643 AGCCCTCCCCACAGAGCCAAAGG + Intronic
1053105197 9:35403049-35403071 AGCAATCACCACAGTAACCATGG - Intronic
1053164080 9:35832492-35832514 AGCCATCCCCACAGTGGCCAGGG - Intronic
1054452330 9:65409868-65409890 AGACAGCCCCTCAGAGGCCAGGG + Intergenic
1055182280 9:73402523-73402545 TGGGTTCCCCACAGTGGCCAGGG - Intergenic
1055795817 9:79973901-79973923 AGGCTTCTCCACTGTGGCCAGGG - Intergenic
1056312808 9:85358495-85358517 CCCAACCCCCACAGTGGCCATGG - Intergenic
1057034816 9:91804365-91804387 TGCCAGCCCCACAGCTGCCAAGG + Intronic
1057178656 9:93017452-93017474 AGCCCTCCCGACAGGGGACAGGG + Intronic
1057730657 9:97605448-97605470 TGCCATGCCCACAGTGCCCCGGG + Intronic
1059476274 9:114550516-114550538 GGGCATCTCCACTGTGGCCAGGG + Intergenic
1061191836 9:129086626-129086648 AGCCATCCCCACCATTGCCCGGG - Intronic
1061255068 9:129450482-129450504 AGCCTTGCACACAGTGGACATGG - Intergenic
1061773258 9:132944273-132944295 AGCCGTCCCCTCGGGGGCCAAGG + Intronic
1062033757 9:134373616-134373638 AGCTATCCACAGAGAGGCCAGGG + Intronic
1062277036 9:135736147-135736169 AGCCATCACCCCCCTGGCCAGGG + Intronic
1062572414 9:137191758-137191780 AGCCTGCCTCACAGTGGCCATGG - Exonic
1187882722 X:23861686-23861708 AGCCCTCCTCACACTGGCCCTGG + Intronic
1188310916 X:28615610-28615632 AGCCAGCCCCTCAAAGGCCATGG + Intronic
1200077784 X:153560251-153560273 ACCCAGCCCCAGAGTGGCCACGG + Intronic
1200914518 Y:8559763-8559785 TGCCATCCCCACAGATGGCATGG + Intergenic
1201060279 Y:10038256-10038278 AGCCAACTCCCCAGAGGCCAAGG - Intergenic
1202585228 Y:26416999-26417021 AGTCATCCCTACAGAGGCAAGGG - Intergenic