ID: 1053168940

View in Genome Browser
Species Human (GRCh38)
Location 9:35864763-35864785
Sequence TGGCCAGTAGGTGAGAGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 215}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053168940_1053168951 16 Left 1053168940 9:35864763-35864785 CCTTACCTCTCACCTACTGGCCA 0: 1
1: 0
2: 1
3: 18
4: 215
Right 1053168951 9:35864802-35864824 AGGGAGCTGGAGCCAGGTGAGGG 0: 1
1: 0
2: 5
3: 72
4: 621
1053168940_1053168955 30 Left 1053168940 9:35864763-35864785 CCTTACCTCTCACCTACTGGCCA 0: 1
1: 0
2: 1
3: 18
4: 215
Right 1053168955 9:35864816-35864838 AGGTGAGGGGAGCTGTGGTTTGG 0: 1
1: 0
2: 4
3: 29
4: 383
1053168940_1053168944 -4 Left 1053168940 9:35864763-35864785 CCTTACCTCTCACCTACTGGCCA 0: 1
1: 0
2: 1
3: 18
4: 215
Right 1053168944 9:35864782-35864804 GCCATGGCCTAAATGTCTGTAGG 0: 1
1: 0
2: 1
3: 6
4: 99
1053168940_1053168948 3 Left 1053168940 9:35864763-35864785 CCTTACCTCTCACCTACTGGCCA 0: 1
1: 0
2: 1
3: 18
4: 215
Right 1053168948 9:35864789-35864811 CCTAAATGTCTGTAGGGAGCTGG 0: 1
1: 0
2: 2
3: 11
4: 138
1053168940_1053168953 25 Left 1053168940 9:35864763-35864785 CCTTACCTCTCACCTACTGGCCA 0: 1
1: 0
2: 1
3: 18
4: 215
Right 1053168953 9:35864811-35864833 GAGCCAGGTGAGGGGAGCTGTGG 0: 1
1: 1
2: 5
3: 90
4: 777
1053168940_1053168949 10 Left 1053168940 9:35864763-35864785 CCTTACCTCTCACCTACTGGCCA 0: 1
1: 0
2: 1
3: 18
4: 215
Right 1053168949 9:35864796-35864818 GTCTGTAGGGAGCTGGAGCCAGG 0: 1
1: 0
2: 1
3: 23
4: 298
1053168940_1053168946 -3 Left 1053168940 9:35864763-35864785 CCTTACCTCTCACCTACTGGCCA 0: 1
1: 0
2: 1
3: 18
4: 215
Right 1053168946 9:35864783-35864805 CCATGGCCTAAATGTCTGTAGGG 0: 1
1: 0
2: 0
3: 10
4: 100
1053168940_1053168952 17 Left 1053168940 9:35864763-35864785 CCTTACCTCTCACCTACTGGCCA 0: 1
1: 0
2: 1
3: 18
4: 215
Right 1053168952 9:35864803-35864825 GGGAGCTGGAGCCAGGTGAGGGG 0: 1
1: 2
2: 6
3: 145
4: 1316
1053168940_1053168950 15 Left 1053168940 9:35864763-35864785 CCTTACCTCTCACCTACTGGCCA 0: 1
1: 0
2: 1
3: 18
4: 215
Right 1053168950 9:35864801-35864823 TAGGGAGCTGGAGCCAGGTGAGG 0: 1
1: 0
2: 4
3: 40
4: 481

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053168940 Original CRISPR TGGCCAGTAGGTGAGAGGTA AGG (reversed) Intergenic