ID: 1053168945

View in Genome Browser
Species Human (GRCh38)
Location 9:35864783-35864805
Sequence CCCTACAGACATTTAGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 96}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053168945_1053168953 5 Left 1053168945 9:35864783-35864805 CCATGGCCTAAATGTCTGTAGGG 0: 1
1: 0
2: 2
3: 18
4: 96
Right 1053168953 9:35864811-35864833 GAGCCAGGTGAGGGGAGCTGTGG 0: 1
1: 1
2: 5
3: 90
4: 777
1053168945_1053168952 -3 Left 1053168945 9:35864783-35864805 CCATGGCCTAAATGTCTGTAGGG 0: 1
1: 0
2: 2
3: 18
4: 96
Right 1053168952 9:35864803-35864825 GGGAGCTGGAGCCAGGTGAGGGG 0: 1
1: 2
2: 6
3: 145
4: 1316
1053168945_1053168950 -5 Left 1053168945 9:35864783-35864805 CCATGGCCTAAATGTCTGTAGGG 0: 1
1: 0
2: 2
3: 18
4: 96
Right 1053168950 9:35864801-35864823 TAGGGAGCTGGAGCCAGGTGAGG 0: 1
1: 0
2: 4
3: 40
4: 481
1053168945_1053168955 10 Left 1053168945 9:35864783-35864805 CCATGGCCTAAATGTCTGTAGGG 0: 1
1: 0
2: 2
3: 18
4: 96
Right 1053168955 9:35864816-35864838 AGGTGAGGGGAGCTGTGGTTTGG 0: 1
1: 0
2: 4
3: 29
4: 383
1053168945_1053168949 -10 Left 1053168945 9:35864783-35864805 CCATGGCCTAAATGTCTGTAGGG 0: 1
1: 0
2: 2
3: 18
4: 96
Right 1053168949 9:35864796-35864818 GTCTGTAGGGAGCTGGAGCCAGG 0: 1
1: 0
2: 1
3: 23
4: 298
1053168945_1053168951 -4 Left 1053168945 9:35864783-35864805 CCATGGCCTAAATGTCTGTAGGG 0: 1
1: 0
2: 2
3: 18
4: 96
Right 1053168951 9:35864802-35864824 AGGGAGCTGGAGCCAGGTGAGGG 0: 1
1: 0
2: 5
3: 72
4: 621
1053168945_1053168956 11 Left 1053168945 9:35864783-35864805 CCATGGCCTAAATGTCTGTAGGG 0: 1
1: 0
2: 2
3: 18
4: 96
Right 1053168956 9:35864817-35864839 GGTGAGGGGAGCTGTGGTTTGGG 0: 1
1: 0
2: 2
3: 33
4: 363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053168945 Original CRISPR CCCTACAGACATTTAGGCCA TGG (reversed) Intergenic