ID: 1053168949

View in Genome Browser
Species Human (GRCh38)
Location 9:35864796-35864818
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 298}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053168943_1053168949 -2 Left 1053168943 9:35864775-35864797 CCTACTGGCCATGGCCTAAATGT 0: 1
1: 0
2: 0
3: 9
4: 121
Right 1053168949 9:35864796-35864818 GTCTGTAGGGAGCTGGAGCCAGG 0: 1
1: 0
2: 1
3: 23
4: 298
1053168945_1053168949 -10 Left 1053168945 9:35864783-35864805 CCATGGCCTAAATGTCTGTAGGG 0: 1
1: 0
2: 2
3: 18
4: 96
Right 1053168949 9:35864796-35864818 GTCTGTAGGGAGCTGGAGCCAGG 0: 1
1: 0
2: 1
3: 23
4: 298
1053168940_1053168949 10 Left 1053168940 9:35864763-35864785 CCTTACCTCTCACCTACTGGCCA 0: 1
1: 0
2: 1
3: 18
4: 215
Right 1053168949 9:35864796-35864818 GTCTGTAGGGAGCTGGAGCCAGG 0: 1
1: 0
2: 1
3: 23
4: 298
1053168942_1053168949 5 Left 1053168942 9:35864768-35864790 CCTCTCACCTACTGGCCATGGCC 0: 1
1: 0
2: 1
3: 22
4: 188
Right 1053168949 9:35864796-35864818 GTCTGTAGGGAGCTGGAGCCAGG 0: 1
1: 0
2: 1
3: 23
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053168949 Original CRISPR GTCTGTAGGGAGCTGGAGCC AGG Intergenic