ID: 1053168952

View in Genome Browser
Species Human (GRCh38)
Location 9:35864803-35864825
Sequence GGGAGCTGGAGCCAGGTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1470
Summary {0: 1, 1: 2, 2: 6, 3: 145, 4: 1316}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053168940_1053168952 17 Left 1053168940 9:35864763-35864785 CCTTACCTCTCACCTACTGGCCA 0: 1
1: 0
2: 1
3: 18
4: 215
Right 1053168952 9:35864803-35864825 GGGAGCTGGAGCCAGGTGAGGGG 0: 1
1: 2
2: 6
3: 145
4: 1316
1053168945_1053168952 -3 Left 1053168945 9:35864783-35864805 CCATGGCCTAAATGTCTGTAGGG 0: 1
1: 0
2: 2
3: 18
4: 96
Right 1053168952 9:35864803-35864825 GGGAGCTGGAGCCAGGTGAGGGG 0: 1
1: 2
2: 6
3: 145
4: 1316
1053168943_1053168952 5 Left 1053168943 9:35864775-35864797 CCTACTGGCCATGGCCTAAATGT 0: 1
1: 0
2: 0
3: 9
4: 121
Right 1053168952 9:35864803-35864825 GGGAGCTGGAGCCAGGTGAGGGG 0: 1
1: 2
2: 6
3: 145
4: 1316
1053168942_1053168952 12 Left 1053168942 9:35864768-35864790 CCTCTCACCTACTGGCCATGGCC 0: 1
1: 0
2: 1
3: 22
4: 188
Right 1053168952 9:35864803-35864825 GGGAGCTGGAGCCAGGTGAGGGG 0: 1
1: 2
2: 6
3: 145
4: 1316
1053168947_1053168952 -9 Left 1053168947 9:35864789-35864811 CCTAAATGTCTGTAGGGAGCTGG 0: 1
1: 0
2: 1
3: 11
4: 136
Right 1053168952 9:35864803-35864825 GGGAGCTGGAGCCAGGTGAGGGG 0: 1
1: 2
2: 6
3: 145
4: 1316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053168952 Original CRISPR GGGAGCTGGAGCCAGGTGAG GGG Intergenic