ID: 1053168956

View in Genome Browser
Species Human (GRCh38)
Location 9:35864817-35864839
Sequence GGTGAGGGGAGCTGTGGTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 363}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053168943_1053168956 19 Left 1053168943 9:35864775-35864797 CCTACTGGCCATGGCCTAAATGT 0: 1
1: 0
2: 0
3: 9
4: 121
Right 1053168956 9:35864817-35864839 GGTGAGGGGAGCTGTGGTTTGGG 0: 1
1: 0
2: 2
3: 33
4: 363
1053168945_1053168956 11 Left 1053168945 9:35864783-35864805 CCATGGCCTAAATGTCTGTAGGG 0: 1
1: 0
2: 2
3: 18
4: 96
Right 1053168956 9:35864817-35864839 GGTGAGGGGAGCTGTGGTTTGGG 0: 1
1: 0
2: 2
3: 33
4: 363
1053168942_1053168956 26 Left 1053168942 9:35864768-35864790 CCTCTCACCTACTGGCCATGGCC 0: 1
1: 0
2: 1
3: 22
4: 188
Right 1053168956 9:35864817-35864839 GGTGAGGGGAGCTGTGGTTTGGG 0: 1
1: 0
2: 2
3: 33
4: 363
1053168947_1053168956 5 Left 1053168947 9:35864789-35864811 CCTAAATGTCTGTAGGGAGCTGG 0: 1
1: 0
2: 1
3: 11
4: 136
Right 1053168956 9:35864817-35864839 GGTGAGGGGAGCTGTGGTTTGGG 0: 1
1: 0
2: 2
3: 33
4: 363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053168956 Original CRISPR GGTGAGGGGAGCTGTGGTTT GGG Intergenic