ID: 1053174387

View in Genome Browser
Species Human (GRCh38)
Location 9:35911697-35911719
Sequence CCAGGACCTGTTTGTTGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053174380_1053174387 -5 Left 1053174380 9:35911679-35911701 CCTGAATAGATGGCTCTCCCAGG 0: 1
1: 0
2: 1
3: 9
4: 104
Right 1053174387 9:35911697-35911719 CCAGGACCTGTTTGTTGAGGGGG No data
1053174379_1053174387 -4 Left 1053174379 9:35911678-35911700 CCCTGAATAGATGGCTCTCCCAG 0: 1
1: 0
2: 0
3: 9
4: 122
Right 1053174387 9:35911697-35911719 CCAGGACCTGTTTGTTGAGGGGG No data
1053174375_1053174387 23 Left 1053174375 9:35911651-35911673 CCTCCTGGCTCTTATGTCTGTAT 0: 1
1: 0
2: 2
3: 17
4: 225
Right 1053174387 9:35911697-35911719 CCAGGACCTGTTTGTTGAGGGGG No data
1053174376_1053174387 20 Left 1053174376 9:35911654-35911676 CCTGGCTCTTATGTCTGTATCCA 0: 1
1: 0
2: 1
3: 19
4: 147
Right 1053174387 9:35911697-35911719 CCAGGACCTGTTTGTTGAGGGGG No data
1053174378_1053174387 0 Left 1053174378 9:35911674-35911696 CCAGCCCTGAATAGATGGCTCTC 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1053174387 9:35911697-35911719 CCAGGACCTGTTTGTTGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053174387 Original CRISPR CCAGGACCTGTTTGTTGAGG GGG Intergenic
No off target data available for this crispr