ID: 1053175200

View in Genome Browser
Species Human (GRCh38)
Location 9:35917562-35917584
Sequence GTCTCCCTCCACTGCTGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053175200_1053175207 -3 Left 1053175200 9:35917562-35917584 CCATCCCAGCAGTGGAGGGAGAC No data
Right 1053175207 9:35917582-35917604 GACAGCAGGGTCCACAGCTGGGG No data
1053175200_1053175210 10 Left 1053175200 9:35917562-35917584 CCATCCCAGCAGTGGAGGGAGAC No data
Right 1053175210 9:35917595-35917617 ACAGCTGGGGAGGAGCTTCCTGG No data
1053175200_1053175205 -5 Left 1053175200 9:35917562-35917584 CCATCCCAGCAGTGGAGGGAGAC No data
Right 1053175205 9:35917580-35917602 GAGACAGCAGGGTCCACAGCTGG No data
1053175200_1053175208 0 Left 1053175200 9:35917562-35917584 CCATCCCAGCAGTGGAGGGAGAC No data
Right 1053175208 9:35917585-35917607 AGCAGGGTCCACAGCTGGGGAGG No data
1053175200_1053175206 -4 Left 1053175200 9:35917562-35917584 CCATCCCAGCAGTGGAGGGAGAC No data
Right 1053175206 9:35917581-35917603 AGACAGCAGGGTCCACAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053175200 Original CRISPR GTCTCCCTCCACTGCTGGGA TGG (reversed) Intergenic
No off target data available for this crispr