ID: 1053176544

View in Genome Browser
Species Human (GRCh38)
Location 9:35929479-35929501
Sequence GCAAAGTTCACAGCCCCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053176537_1053176544 18 Left 1053176537 9:35929438-35929460 CCTGAAGAGCACAGTTAGTCCAG No data
Right 1053176544 9:35929479-35929501 GCAAAGTTCACAGCCCCTTTGGG No data
1053176542_1053176544 -1 Left 1053176542 9:35929457-35929479 CCAGGAAAGAAACTGAAGGGGAG No data
Right 1053176544 9:35929479-35929501 GCAAAGTTCACAGCCCCTTTGGG No data
1053176536_1053176544 25 Left 1053176536 9:35929431-35929453 CCTGCTTCCTGAAGAGCACAGTT No data
Right 1053176544 9:35929479-35929501 GCAAAGTTCACAGCCCCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053176544 Original CRISPR GCAAAGTTCACAGCCCCTTT GGG Intergenic
No off target data available for this crispr