ID: 1053177500

View in Genome Browser
Species Human (GRCh38)
Location 9:35938645-35938667
Sequence TGGAGGGCCCAGCACTTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053177490_1053177500 22 Left 1053177490 9:35938600-35938622 CCCACAGGTCAAATCCCGAGGTG No data
Right 1053177500 9:35938645-35938667 TGGAGGGCCCAGCACTTTCCAGG No data
1053177493_1053177500 8 Left 1053177493 9:35938614-35938636 CCCGAGGTGTGGTCAGCCCACAG No data
Right 1053177500 9:35938645-35938667 TGGAGGGCCCAGCACTTTCCAGG No data
1053177499_1053177500 -9 Left 1053177499 9:35938631-35938653 CCACAGAAGAATTTTGGAGGGCC No data
Right 1053177500 9:35938645-35938667 TGGAGGGCCCAGCACTTTCCAGG No data
1053177486_1053177500 28 Left 1053177486 9:35938594-35938616 CCCTGCCCCACAGGTCAAATCCC No data
Right 1053177500 9:35938645-35938667 TGGAGGGCCCAGCACTTTCCAGG No data
1053177489_1053177500 23 Left 1053177489 9:35938599-35938621 CCCCACAGGTCAAATCCCGAGGT No data
Right 1053177500 9:35938645-35938667 TGGAGGGCCCAGCACTTTCCAGG No data
1053177498_1053177500 -8 Left 1053177498 9:35938630-35938652 CCCACAGAAGAATTTTGGAGGGC No data
Right 1053177500 9:35938645-35938667 TGGAGGGCCCAGCACTTTCCAGG No data
1053177494_1053177500 7 Left 1053177494 9:35938615-35938637 CCGAGGTGTGGTCAGCCCACAGA No data
Right 1053177500 9:35938645-35938667 TGGAGGGCCCAGCACTTTCCAGG No data
1053177491_1053177500 21 Left 1053177491 9:35938601-35938623 CCACAGGTCAAATCCCGAGGTGT No data
Right 1053177500 9:35938645-35938667 TGGAGGGCCCAGCACTTTCCAGG No data
1053177487_1053177500 27 Left 1053177487 9:35938595-35938617 CCTGCCCCACAGGTCAAATCCCG No data
Right 1053177500 9:35938645-35938667 TGGAGGGCCCAGCACTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053177500 Original CRISPR TGGAGGGCCCAGCACTTTCC AGG Intergenic
No off target data available for this crispr