ID: 1053181228

View in Genome Browser
Species Human (GRCh38)
Location 9:35972182-35972204
Sequence CCGCCGATGTGAGGCCGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053181217_1053181228 16 Left 1053181217 9:35972143-35972165 CCTTCGTTGCGATGACCTTCTTG No data
Right 1053181228 9:35972182-35972204 CCGCCGATGTGAGGCCGCCCGGG No data
1053181216_1053181228 22 Left 1053181216 9:35972137-35972159 CCAAAACCTTCGTTGCGATGACC No data
Right 1053181228 9:35972182-35972204 CCGCCGATGTGAGGCCGCCCGGG No data
1053181223_1053181228 -10 Left 1053181223 9:35972169-35972191 CCGCCGGCAGGCGCCGCCGATGT No data
Right 1053181228 9:35972182-35972204 CCGCCGATGTGAGGCCGCCCGGG No data
1053181221_1053181228 -8 Left 1053181221 9:35972167-35972189 CCCCGCCGGCAGGCGCCGCCGAT No data
Right 1053181228 9:35972182-35972204 CCGCCGATGTGAGGCCGCCCGGG No data
1053181220_1053181228 1 Left 1053181220 9:35972158-35972180 CCTTCTTGTCCCCGCCGGCAGGC No data
Right 1053181228 9:35972182-35972204 CCGCCGATGTGAGGCCGCCCGGG No data
1053181222_1053181228 -9 Left 1053181222 9:35972168-35972190 CCCGCCGGCAGGCGCCGCCGATG No data
Right 1053181228 9:35972182-35972204 CCGCCGATGTGAGGCCGCCCGGG No data
1053181215_1053181228 23 Left 1053181215 9:35972136-35972158 CCCAAAACCTTCGTTGCGATGAC No data
Right 1053181228 9:35972182-35972204 CCGCCGATGTGAGGCCGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053181228 Original CRISPR CCGCCGATGTGAGGCCGCCC GGG Intergenic
No off target data available for this crispr