ID: 1053184959

View in Genome Browser
Species Human (GRCh38)
Location 9:36008230-36008252
Sequence GAGGAGAAGGAGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053184959_1053184968 7 Left 1053184959 9:36008230-36008252 CCCTCCTCCTTCTCCTTCTCCTC No data
Right 1053184968 9:36008260-36008282 TATTCAATGTGAAGACAAGGAGG No data
1053184959_1053184966 4 Left 1053184959 9:36008230-36008252 CCCTCCTCCTTCTCCTTCTCCTC No data
Right 1053184966 9:36008257-36008279 GCCTATTCAATGTGAAGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053184959 Original CRISPR GAGGAGAAGGAGAAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr