ID: 1053189937

View in Genome Browser
Species Human (GRCh38)
Location 9:36055821-36055843
Sequence TTGTTGTTGTTGAGGGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053189932_1053189937 21 Left 1053189932 9:36055777-36055799 CCTGTTTCAAGTACTTGTAGGTT 0: 1
1: 0
2: 1
3: 8
4: 134
Right 1053189937 9:36055821-36055843 TTGTTGTTGTTGAGGGGAGATGG No data
1053189933_1053189937 -7 Left 1053189933 9:36055805-36055827 CCTTTTTTGTTTGTTTTTGTTGT 0: 1
1: 24
2: 201
3: 1752
4: 33904
Right 1053189937 9:36055821-36055843 TTGTTGTTGTTGAGGGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053189937 Original CRISPR TTGTTGTTGTTGAGGGGAGA TGG Intronic
No off target data available for this crispr