ID: 1053192649

View in Genome Browser
Species Human (GRCh38)
Location 9:36086005-36086027
Sequence TGTATTGGCAAAGATGGAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 264}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053192649_1053192654 -3 Left 1053192649 9:36086005-36086027 CCGTCTCCATCTTTGCCAATACA 0: 1
1: 0
2: 0
3: 22
4: 264
Right 1053192654 9:36086025-36086047 ACAGAGGAATCTGGAAAAGAAGG 0: 1
1: 0
2: 8
3: 52
4: 498

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053192649 Original CRISPR TGTATTGGCAAAGATGGAGA CGG (reversed) Intronic
901151135 1:7102584-7102606 TGTATGCGCAAGGATGGAGGAGG + Intronic
904821847 1:33250432-33250454 TGTATGGACATAGATGGAGCTGG + Intergenic
904853067 1:33473638-33473660 TCTCTTGGCAAAGAAGGTGAAGG - Intronic
904974247 1:34443556-34443578 AGTATTGGCCATGATGAAGATGG - Intergenic
907503506 1:54901017-54901039 TGTATTGATTAAGAAGGAGACGG + Intergenic
907788964 1:57642678-57642700 TAAATTGGCACAGCTGGAGAAGG - Intronic
908160430 1:61402536-61402558 GGTATTTACGAAGATGGAGAAGG + Intronic
908763786 1:67536332-67536354 TGTAATGGGAAAAATTGAGACGG + Intergenic
910766775 1:90790005-90790027 CGTAATGGCGAAGAGGGAGATGG + Intergenic
912976701 1:114337424-114337446 TCTATTAGAAAAGAGGGAGAGGG + Intergenic
915528874 1:156492018-156492040 TGTCTAGGCAGAGATGGGGAAGG + Intronic
917536024 1:175875284-175875306 TGTATTGGCAAAGACTGAAGGGG - Intergenic
918606360 1:186431759-186431781 AGTAATGGCAAAGATGTGGAAGG + Intergenic
918682852 1:187377059-187377081 TGTATTAAGAAAGATGCAGAGGG - Intergenic
920760000 1:208774342-208774364 TTTGTTGGCAAAGGTGGAGTTGG + Intergenic
920855347 1:209657139-209657161 TCTATGGGCACAGATGGAGAAGG + Intergenic
922401457 1:225261688-225261710 TGTTTTGGAAGAGTTGGAGAAGG + Intronic
923969056 1:239178990-239179012 TGTATAGGCAAAAATCGAGTTGG + Intergenic
924016908 1:239736699-239736721 TGTATTGGCATAGCTGGTTATGG - Intronic
1062962219 10:1581122-1581144 TGTATTGGCGAGGATATAGAGGG - Intronic
1064239703 10:13615160-13615182 TGCATTGGCATGGATGGATAAGG + Intronic
1066029439 10:31404792-31404814 TGTGGTGGCTAAGATAGAGAAGG + Intronic
1067485300 10:46643528-46643550 TTTATTGGGAAAGACTGAGAGGG - Intergenic
1068274659 10:54778182-54778204 TGTATTTGCACTGATCGAGATGG + Intronic
1069096592 10:64266905-64266927 TGTATCGGAATAGAAGGAGAGGG - Intergenic
1071625046 10:87159782-87159804 TTTATTGGGAAAGACTGAGAGGG + Intronic
1072380662 10:94866130-94866152 TGTATTGGTAATGAGGCAGAAGG - Intergenic
1073382486 10:103090127-103090149 GAAATTGGAAAAGATGGAGAGGG + Exonic
1074259724 10:111839814-111839836 TCTTTTGGAAAAGCTGGAGAAGG + Intergenic
1075381209 10:122019918-122019940 TGTCTTGGGAAAGCCGGAGAGGG + Intronic
1076511188 10:131014660-131014682 TGTGTTGGCAATGAGGGAAAGGG + Intergenic
1077427260 11:2488403-2488425 TTTTTTGGGAAAGATTGAGAAGG + Intronic
1077789394 11:5422313-5422335 GGTATTGCCCATGATGGAGATGG - Exonic
1078257943 11:9676238-9676260 TGTATTGAGAGAGATGGAAAGGG + Intronic
1078519972 11:12055006-12055028 GGTATCTGCAAAGATGGGGATGG - Intergenic
1078730537 11:13970200-13970222 TGTTTTGGCAGGGATGGAGTTGG + Intronic
1079592686 11:22199444-22199466 TCTATTAGCAAAGAAGGAGGAGG + Intronic
1079595142 11:22235096-22235118 ATTATTGCAAAAGATGGAGAGGG - Intronic
1080020227 11:27552397-27552419 CTTATTGACAGAGATGGAGAAGG + Intergenic
1080175209 11:29355064-29355086 CATTTTGGCAAAGATGTAGATGG + Intergenic
1080439895 11:32283046-32283068 TATATTGGCAAAGATGCTCATGG + Intergenic
1085177886 11:74506784-74506806 TGAATTGGCACAGACAGAGATGG + Intronic
1085268420 11:75252273-75252295 GGTTTCGGCAAAGATGGAGAGGG - Intergenic
1085793007 11:79512305-79512327 TATGTTGACAAAGATAGAGAAGG + Intergenic
1087849155 11:103008967-103008989 TGTAGGGGCAACGAAGGAGAAGG - Intergenic
1087942324 11:104113322-104113344 TGCATTGGCAAGGATGGGGGAGG + Intronic
1088555015 11:111052741-111052763 TGTATTGACTAAGAAGGGGAAGG - Intergenic
1089220714 11:116869211-116869233 TCTATTGGCCAAGCTGTAGAAGG + Intronic
1091751384 12:3023205-3023227 TCTATTGGCAGAGATGGGAAAGG + Intronic
1093167507 12:15821938-15821960 TGTATGGGCAACTATGGAGAGGG - Intronic
1093634975 12:21455518-21455540 TCTGTTTGCAAAGATGCAGATGG - Intronic
1093751463 12:22804890-22804912 TGTAATGGGAAAGGAGGAGATGG - Intergenic
1097651090 12:62298055-62298077 TGAATTGGCAAACTTGTAGACGG + Intronic
1098640923 12:72838188-72838210 TGTATTAGAAAATTTGGAGAGGG + Intergenic
1098653769 12:73005126-73005148 TGTATTGACTAAGAAGGGGATGG + Intergenic
1099421612 12:82468933-82468955 TCTATTGGCTGAGTTGGAGAAGG - Intronic
1101049506 12:100846771-100846793 TGGGTTGGCAAAGAAGGAAAAGG - Intronic
1101551107 12:105763310-105763332 TGTATTGGAAAAGCTGAGGAGGG + Intergenic
1101671702 12:106881468-106881490 TGTAATGGCAGTGATGGACATGG - Intronic
1102984078 12:117264639-117264661 TGTAGAGGGAAAGAGGGAGAGGG - Intronic
1104776768 12:131393960-131393982 TGAATTGGCCAAGACGGACAGGG - Intergenic
1105782000 13:23714056-23714078 TGTTTTTGAATAGATGGAGAAGG - Intergenic
1105803995 13:23938992-23939014 TGTTTTTGAATAGATGGAGAAGG - Intergenic
1105806723 13:23955783-23955805 TGTTTTTGGATAGATGGAGAAGG + Intergenic
1106633870 13:31506480-31506502 TCTATAGGCAAAGATGTGGATGG + Intergenic
1106780301 13:33052328-33052350 TGTGATGGGGAAGATGGAGAAGG + Intronic
1106998562 13:35517603-35517625 TGATCTGCCAAAGATGGAGATGG - Intronic
1107601028 13:42012494-42012516 GGTAATGGCAATGATGGTGATGG + Intergenic
1108876389 13:55055118-55055140 TGTAATGGCTAAGAGAGAGATGG + Intergenic
1109531602 13:63655910-63655932 TGTAGTGGAAATGAGGGAGATGG - Intergenic
1109937938 13:69317793-69317815 TGAATTTGTAAATATGGAGAAGG + Intergenic
1110228274 13:73142541-73142563 TATATTGGGAAAGAGGCAGAGGG - Intergenic
1110748949 13:79090402-79090424 TGGATGGGCAGTGATGGAGAGGG - Intergenic
1110749434 13:79095544-79095566 TGGATGGGCAGTGATGGAGAGGG - Intergenic
1110910485 13:80955907-80955929 TGTAGTGACATAGATGGAGCTGG + Intergenic
1110978544 13:81868727-81868749 TGTATTGACTAAGAAGGGGACGG - Intergenic
1111439480 13:88260985-88261007 TGTATTGGGCAAAATAGAGAAGG - Intergenic
1111458778 13:88515979-88516001 TGTATTGACTAAGAAGGGGACGG + Intergenic
1113198145 13:107833594-107833616 TGTAATGGAAAGGATTGAGAAGG - Intronic
1113600633 13:111565969-111565991 TGTATTGGCAGACATGGGGCTGG - Intergenic
1114220662 14:20693552-20693574 TGTGTTGGAAGAGATGGTGATGG + Exonic
1115019516 14:28659358-28659380 AGTATTGGCAAGGATGAAAAGGG + Intergenic
1115410031 14:33063558-33063580 TGTATTTACAAAAATGGAGGGGG - Intronic
1116359215 14:43971951-43971973 AGAACTGGCAAAGAAGGAGAGGG - Intergenic
1116745311 14:48810443-48810465 TGCTTTGGCCAAGATGGTGATGG + Intergenic
1119187255 14:72651627-72651649 GTTATTTGCAAAGATGGAGGTGG + Intronic
1120396610 14:83974798-83974820 TGAAATGGCAAAGATGGTGGTGG + Intergenic
1120894614 14:89518541-89518563 TTTCTTGGCAAAGGTGGGGAGGG - Intronic
1121601224 14:95204564-95204586 TGTTTTGGGAAAGGTGGATATGG - Intronic
1124906569 15:33874040-33874062 AGTATTGGGAAGGATGGGGAGGG - Intronic
1127956495 15:63858382-63858404 AGTAGTAGCAATGATGGAGATGG + Intergenic
1128939805 15:71778769-71778791 TGAATTGGAAGAGATGGGGAAGG - Exonic
1129164141 15:73766653-73766675 TGCAGTGCCAATGATGGAGATGG + Intergenic
1129361187 15:75025418-75025440 TATATGGGCAAAGGTGGAGCTGG - Intronic
1129932218 15:79421435-79421457 TGCAGTGGCAAAGATGCAGGAGG - Intronic
1130117866 15:81021258-81021280 AGTCTTGGGAAAGATGGGGAGGG - Intronic
1130912640 15:88281612-88281634 TTTAGCGGCAGAGATGGAGATGG - Intergenic
1131717926 15:95133626-95133648 GGTATTGGCAGTGATGGTGATGG - Intergenic
1131825517 15:96320287-96320309 TGTACTGGCAAAAAGGCAGAAGG - Intergenic
1131857143 15:96609682-96609704 TGTATTGGCAAAGTTCGTTAAGG + Intergenic
1134357661 16:13499295-13499317 AGTTTTGGCAAAGAAAGAGATGG + Intergenic
1134860141 16:17553599-17553621 AGTATTTGCCAAGAAGGAGAAGG + Intergenic
1135158874 16:20075762-20075784 TGCATTGGGAATGATGGATAAGG + Intergenic
1138212344 16:55174040-55174062 TGTGGGGACAAAGATGGAGAAGG + Intergenic
1138544625 16:57708741-57708763 AGTATTGGCAAGGATGTGGATGG - Intronic
1140284107 16:73584632-73584654 TGTAAAGTCAAAGATGAAGACGG + Intergenic
1140435483 16:74943451-74943473 TGTATTGGCAGAGAGGGAAAAGG - Intronic
1141070260 16:80948210-80948232 TGCACTGGCAAGGATGTAGAGGG - Intergenic
1142576539 17:912466-912488 AGTGTTGGCAAGGATGTAGACGG - Intronic
1143506296 17:7367395-7367417 TTTATGGGCAAAGGTGGGGATGG + Intergenic
1144184638 17:12785578-12785600 AGCATTGGCCAAGATGGAGATGG - Intergenic
1144242008 17:13321798-13321820 TGTCTTGGCATAGATGAACAAGG + Intergenic
1144760815 17:17706315-17706337 TGTAGTGGCCAAGCTGGAGGGGG + Intronic
1146114943 17:30127077-30127099 TTTATTTACAAAAATGGAGATGG + Intronic
1148708839 17:49661437-49661459 TCCATTGGCAGAGATGGGGAAGG - Intronic
1148972957 17:51500318-51500340 TATATTGGCAGAGAGGGAAAGGG - Intergenic
1149383450 17:56117878-56117900 AGAATTGGCAGAGATGGATAGGG - Intronic
1150024432 17:61657521-61657543 TGTTTTGGCAGAGTTTGAGAAGG + Intergenic
1153406615 18:4747911-4747933 TATATTGGGAGAGATGGAGAGGG - Intergenic
1156024579 18:32637408-32637430 TGGATTGACAAAGATGGAGCTGG + Intergenic
1156051543 18:32941683-32941705 AGTATGGGCAAAGGTGCAGATGG + Intronic
1156976559 18:43228635-43228657 TATATTGTCAAAGATGGCAAAGG - Intergenic
1157534238 18:48446883-48446905 TGTGTTGGCAAAGGAGGAGCTGG - Intergenic
1158077994 18:53553504-53553526 TGTGTTGGCAGAGGCGGAGAGGG - Intergenic
1162188329 19:8924232-8924254 TGTAGAGACAGAGATGGAGATGG + Intronic
1166912965 19:46173956-46173978 TGTCTGGGCAAAGATGGAGCTGG + Intergenic
1168522829 19:57066082-57066104 TGCATTGCCAAAGCTGGAAAAGG + Intergenic
924987124 2:282104-282126 TCTACTGGGAAAGATGGAGTGGG + Intronic
925971366 2:9108817-9108839 TATAGTGGCACAAATGGAGAAGG + Intergenic
928069871 2:28203940-28203962 AGTATTGGCAAGGATGTAGGAGG - Intronic
928273942 2:29881747-29881769 TGACTTGGAAAAGATGAAGAGGG - Intronic
929494052 2:42424052-42424074 TGGATTTGCAAAGCTGGAGGTGG - Intronic
932153630 2:69395371-69395393 TCTATTGGTTAAGATGGAGATGG - Intergenic
935882966 2:107584849-107584871 AGAATTGGCAAAGTTGGAAAAGG - Intergenic
936755994 2:115713257-115713279 AGTTATGGCAAAGAAGGAGAAGG + Intronic
937195571 2:120152652-120152674 TGTTTTGGAAGAGATTGAGAAGG + Intronic
939516211 2:143171475-143171497 TATATTGCTAAAGATGGAGCTGG + Intronic
940890613 2:159032067-159032089 TGAACTGGCAAAGATTCAGAAGG + Intronic
941066164 2:160905497-160905519 TGTAATGGGAAAGATGGGGCAGG - Intergenic
941555684 2:166977704-166977726 AGTAATCACAAAGATGGAGAGGG + Intronic
942914849 2:181293504-181293526 TGTATTTGTAAAGATGAATAAGG + Intergenic
943901382 2:193442097-193442119 TTTTTTGGCAAAGATGGAAGGGG - Intergenic
945273076 2:207961231-207961253 TTTATTGATGAAGATGGAGAAGG + Intronic
948135567 2:235633613-235633635 TGAATTGTCATAGATGGAGTGGG + Intronic
948731249 2:239965091-239965113 TCTATTTGCAAAGATGAAAATGG - Intronic
1168783515 20:515926-515948 AGTATTGGGAAAGAGAGAGAGGG - Intronic
1172827031 20:37797912-37797934 TGGATACGCAAAGAGGGAGAGGG - Intronic
1173189576 20:40865671-40865693 AGCACTGGCAAAGGTGGAGAAGG - Intergenic
1174887806 20:54354764-54354786 TGTCTTGGGAAGGATGGAGCAGG + Intergenic
1174897596 20:54467522-54467544 TGTCTAGGCAAAGGTAGAGAGGG - Intergenic
1176942816 21:14944464-14944486 TGCCTTGCCAGAGATGGAGAAGG + Intergenic
1176980576 21:15376532-15376554 TGTATTAACAAAGAAGGACAAGG + Intergenic
1179224664 21:39443130-39443152 TGTTTTAGCAGAGATGAAGAGGG + Intronic
1183138616 22:35915030-35915052 TGTAATGGCAAAGGGGGAGGAGG - Intronic
949671212 3:6400234-6400256 CGTATTGGCTAAGAAGGGGACGG - Intergenic
949832647 3:8232523-8232545 TGTAATGTGAAAGAGGGAGAGGG - Intergenic
951001884 3:17572363-17572385 TGTATATGAAAAGATGGAAAAGG - Intronic
951120570 3:18922329-18922351 TGTTTTTGCAAAGATGGGAATGG - Intergenic
951130841 3:19042489-19042511 TGTTTTGTGAGAGATGGAGATGG - Intergenic
951329443 3:21348311-21348333 AGTATGGGCAAAGATAGAAAAGG - Intergenic
952609930 3:35196287-35196309 TGAATTGGGAAACATGGTGAGGG - Intergenic
955573041 3:60328161-60328183 TCTATTGGAAAAGTTGGAAAGGG + Intronic
955808572 3:62762083-62762105 TGGATGGGCACAGATGGAAAAGG + Intronic
958913224 3:100018471-100018493 TGTGTTGTCAAAAATGGAAATGG + Intronic
959050755 3:101523009-101523031 TGTATTAGCAAAGTTGCAGAAGG - Intergenic
959531805 3:107441669-107441691 TGGACTGGGAAAAATGGAGAAGG + Intergenic
959830436 3:110855343-110855365 TCTATTGTCAAGTATGGAGAAGG - Intergenic
959939186 3:112062590-112062612 GGGATTGGCAAAGAAGGACATGG - Intronic
960489413 3:118295470-118295492 TGTATTGGTTAACATTGAGATGG - Intergenic
960552077 3:118987100-118987122 TGTATTTGTAAGGATGGTGATGG - Intronic
961283129 3:125779030-125779052 TGTAGGTGCCAAGATGGAGATGG + Intergenic
964144633 3:153444079-153444101 TGTATTAGAAAAGATTTAGAGGG - Intergenic
964547669 3:157852339-157852361 TGTATTGGTAAAGAAGGGTATGG + Intergenic
965400971 3:168211665-168211687 TTTATTGGCAGAGAGAGAGAGGG + Intergenic
966440080 3:179935087-179935109 TGTAGTGGCAAAGGGGCAGAGGG + Intronic
966628015 3:182039793-182039815 TGTTTTGGAAAAGTAGGAGATGG - Intergenic
967378433 3:188831181-188831203 GGAGTTGGCAAAGATGGAGAAGG + Intronic
969462999 4:7338632-7338654 GGTGTGGGCAAAGCTGGAGAGGG - Intronic
970191079 4:13519490-13519512 TGTATTGGCAGACTTGGAAATGG + Intergenic
972872060 4:43312659-43312681 TGTATTCACAAAGATGGAATTGG + Intergenic
973036226 4:45410784-45410806 TGGATTTTCAAAGAGGGAGACGG + Intergenic
973865782 4:55111343-55111365 TGAGATGGCAAAGATCGAGAAGG - Intronic
973891547 4:55372414-55372436 TGTTTGGGCAAAGAAGGAAAAGG - Exonic
975390596 4:73812704-73812726 TGTATTGGCAAAGCTAGTTATGG + Intergenic
975507875 4:75159349-75159371 TTTACTAGCAAAGATTGAGATGG - Intergenic
975721342 4:77251434-77251456 TGTGGTGCCAAATATGGAGACGG + Intronic
975950884 4:79769720-79769742 TGTATTTGTAAAGAAGGTGAAGG - Intergenic
976120191 4:81772106-81772128 TGTATTTGGAAAGATGTTGAGGG - Intronic
976495278 4:85722012-85722034 TGTGTTGGTAAAGGTGAAGATGG + Intronic
976632764 4:87255964-87255986 TGTATTGCCAAGGAGGAAGAAGG - Intergenic
976708690 4:88045504-88045526 TGTAATGGCAGAGATAGTGATGG + Intronic
976999824 4:91483214-91483236 TGTGTTGGCAAAGATGCTGATGG + Intronic
978246901 4:106583766-106583788 TGTAGTAGCAAAGAAGGAAATGG + Intergenic
981575825 4:146204047-146204069 TGTATAGATAGAGATGGAGATGG + Intergenic
982155842 4:152520093-152520115 AGAATTGGCAAGGAAGGAGAGGG - Intronic
982403415 4:154994222-154994244 TGAATTGGAAAAGATGGAAATGG - Intergenic
983031906 4:162813472-162813494 TGTATTAGAAAAGGTTGAGAAGG + Intergenic
983576057 4:169263119-169263141 TGTCTTCGCACAGATGGGGATGG - Intronic
983781763 4:171677418-171677440 TGATTTTGCAAAGCTGGAGATGG + Intergenic
984187601 4:176565026-176565048 TGACTTGGCTCAGATGGAGAAGG - Intergenic
984226076 4:177036401-177036423 TGTATTTGGAAAACTGGAGATGG + Intergenic
984265538 4:177494868-177494890 AGTATTGGCAAATATGAAGAGGG + Intergenic
984411783 4:179405770-179405792 TGTATTGATTAAGAAGGAGATGG - Intergenic
984536353 4:180980529-180980551 TGTAGAGGCTGAGATGGAGAAGG - Intergenic
986070728 5:4279933-4279955 TTTATTGTCAAATATGGACAAGG - Intergenic
986286940 5:6366074-6366096 CGTGTTGGCACAGATGCAGATGG - Intergenic
987514078 5:18883328-18883350 TCTATTTGCAAAGGTGGGGATGG + Intergenic
987516086 5:18910949-18910971 TGTGTTGGCAAAGATGCATAAGG + Intergenic
987532589 5:19141861-19141883 TGTATGGGCAAAGGTGGATTTGG - Intergenic
987665778 5:20937109-20937131 TGAATATGCAATGATGGAGAAGG - Intergenic
988756913 5:34265058-34265080 TGAATATGCAATGATGGAGAAGG + Intergenic
990852483 5:60222618-60222640 TGTATTAGCAAAGATAGATATGG - Intronic
991219993 5:64202611-64202633 AGTATTGGCAAAGATGTAACTGG - Intronic
993178475 5:84518693-84518715 TGCATTTGCACAGATGGAGGTGG + Intergenic
993892701 5:93492489-93492511 TTTATTGGAAAAGTTTGAGAAGG - Intergenic
994159902 5:96545872-96545894 TGAATGGGCACAGATGGTGAAGG - Intronic
994225454 5:97247471-97247493 AGTCTTGGAAAAGATTGAGAGGG + Intergenic
994324934 5:98437117-98437139 TGTATTGGTTAAGAAGGGGATGG - Intergenic
994522516 5:100858544-100858566 GGTATTGGCAAATACGGATAGGG - Intronic
995928980 5:117412389-117412411 TATATTAGCAGTGATGGAGATGG - Intergenic
998068158 5:139175565-139175587 TGTTTTGGAAAAGTTTGAGAAGG - Intronic
998386967 5:141762665-141762687 CTTGTTGGCAAAGAAGGAGAAGG + Intergenic
998687153 5:144541302-144541324 TGTATTGGAAAAGATTTAAAAGG - Intergenic
999610374 5:153362680-153362702 AGTAATGGCTCAGATGGAGAGGG - Intergenic
1000041490 5:157488183-157488205 GGTAATGGCAAAGGTGGGGAAGG - Intronic
1000396968 5:160786214-160786236 TGTATTTGCAATGATGAAGATGG + Intronic
1002500001 5:179642252-179642274 TGGATTGGGAGAGACGGAGATGG - Intronic
1002501971 5:179652509-179652531 TGGATTGGGAGAGAAGGAGATGG + Intergenic
1011367845 6:86601530-86601552 TGTATTGACTAAGAAGGGGATGG + Intergenic
1011538475 6:88404122-88404144 TCTGTTGGCAAAGCTGGAAAGGG - Intergenic
1013251509 6:108338963-108338985 TGTATTAACAAAGATGTAGGGGG - Intronic
1013361321 6:109396234-109396256 TGAATTGGCAAAGAATGAAAAGG - Intronic
1014162605 6:118187298-118187320 AGTCTCGGCAAAGATGGTGAGGG - Intronic
1014604918 6:123461477-123461499 TGTTGTGGCAAAGATGTGGAAGG - Intronic
1015026889 6:128544449-128544471 TGTTTTGGCAAACATGCAAAAGG - Intergenic
1017401728 6:154072077-154072099 CCTATTGCCAAAGAAGGAGAAGG - Intronic
1017864312 6:158429628-158429650 ACTTTTGGCTAAGATGGAGATGG - Intronic
1020131881 7:5563272-5563294 TGTGTTGGGAGAGAGGGAGAGGG + Intronic
1020439928 7:8206456-8206478 TAAATTGGCAAAAATGGGGAGGG - Intronic
1021667681 7:23002553-23002575 TGTATTGGGAAAGGTGAAGGAGG + Intronic
1022024679 7:26436300-26436322 TACTTTGGCAAAGATAGAGATGG - Intergenic
1027333912 7:77127907-77127929 TGGATTAGCAAAGATTGGGAAGG - Intronic
1030305363 7:108012873-108012895 TGGCTTGGCAGAGAAGGAGAAGG - Intergenic
1030377288 7:108768265-108768287 TGTATTGGAGAAGGTGGTGATGG - Intergenic
1030653813 7:112144400-112144422 AGTATGGGCCATGATGGAGAAGG - Intronic
1030822700 7:114115085-114115107 TGTGATGGCAAAGTTGGAAATGG - Intronic
1031522844 7:122787579-122787601 TCTATTGGCGGAGATGGATATGG - Intronic
1031705170 7:124971810-124971832 TGTAGTGTCAAAAATGAAGAAGG + Intergenic
1031789893 7:126089030-126089052 TCTATTGGAAAAGAGAGAGAAGG + Intergenic
1033932001 7:146535014-146535036 TTTATTAGAAAAGATGGACATGG - Intronic
1037935172 8:22910602-22910624 TGGCTTGGCAACGATGGACAGGG + Intronic
1039100788 8:33939953-33939975 TGTTTTGTTAAAGGTGGAGAGGG + Intergenic
1041362663 8:57069183-57069205 TTTATTGGCAAAGAAAGTGAGGG + Intergenic
1042604017 8:70528199-70528221 TGTATAGGCAGAGATGGTGAAGG + Intergenic
1043034517 8:75179198-75179220 TGTCTGGGCACGGATGGAGAGGG - Intergenic
1043304284 8:78775100-78775122 TGTGTTGGTAAAGCTGGAAAAGG - Intronic
1046629792 8:116612071-116612093 TGTGTTAGAAAAAATGGAGAGGG - Intergenic
1049317990 8:141979824-141979846 TGTCTTGGCAGACATGCAGATGG - Intergenic
1050867326 9:10519169-10519191 TGTACTGGCAAAGCTGGAGGAGG - Intronic
1053192649 9:36086005-36086027 TGTATTGGCAAAGATGGAGACGG - Intronic
1054076759 9:60545004-60545026 TGTCTTTGAAAAGAAGGAGAAGG - Intergenic
1056156355 9:83842386-83842408 TGTATAGAACAAGATGGAGAAGG - Exonic
1056354174 9:85781195-85781217 TGTATAGAACAAGATGGAGAAGG + Intergenic
1056482531 9:87020055-87020077 TGTATTGGCTAGGAGGGAAATGG + Intergenic
1056680424 9:88713020-88713042 AGAATTGGCACAGATGAAGAGGG + Intergenic
1056823109 9:89858056-89858078 TGTCTTGGAAAAGTTTGAGAAGG - Intergenic
1059891561 9:118810300-118810322 AGCAGTGGCAAAGGTGGAGATGG + Intergenic
1059914322 9:119082116-119082138 TGTGTCAGCAAAGATGAAGAGGG + Intergenic
1060588357 9:124800706-124800728 TGTTTTGGCAATGGTGCAGAAGG + Intronic
1061039849 9:128134228-128134250 TGTCTTGGAAAAGTTTGAGAAGG + Intergenic
1062112824 9:134791356-134791378 TGTGATGGCAAAGATGAAGGAGG - Intronic
1186813570 X:13213680-13213702 TGTTTGAGCAAAGAAGGAGAAGG + Intergenic
1186864021 X:13701261-13701283 AGAATAGGCAAATATGGAGATGG - Intronic
1188007364 X:25024655-25024677 TGTCTTGTCAAAGACAGAGAGGG + Intergenic
1188114044 X:26222615-26222637 TTTATTGGTAATGATGGTGAGGG + Intergenic
1188387365 X:29577619-29577641 TGTATTTTAAAAGATGGTGATGG + Intronic
1189774530 X:44458600-44458622 TATATTAGCAAAAATTGAGAAGG - Intergenic
1193244598 X:79213154-79213176 TGCATGGGGGAAGATGGAGAAGG - Intergenic
1193306429 X:79957131-79957153 TGTAATGGCTAAGAGAGAGATGG + Intergenic
1193406928 X:81112023-81112045 TGTACTGACAAAGATTGACATGG + Intergenic
1194695663 X:97046351-97046373 TGTAATGGGAAAGATGAAGATGG + Intronic
1195619496 X:106938855-106938877 TGAAATTGCAAAGATGGAGATGG + Intronic
1198400417 X:136263197-136263219 AGAATTGGCAGAGATGGAGGTGG - Intergenic
1198551635 X:137751535-137751557 TGGAAAGGCAAAGATGGAGCAGG - Intergenic
1199498072 X:148476281-148476303 TGTATTTGGAAAGATGGTGTGGG - Intergenic
1199712063 X:150476703-150476725 TGTTTTGACAAATATGGAGAGGG + Intronic
1201114420 Y:10824541-10824563 TGTAATGGAAAAGAAGGAAACGG - Intergenic