ID: 1053196666

View in Genome Browser
Species Human (GRCh38)
Location 9:36125160-36125182
Sequence AGACATAGAGGACCACAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053196660_1053196666 9 Left 1053196660 9:36125128-36125150 CCATTCCAGCGTCCTCACAAAGG No data
Right 1053196666 9:36125160-36125182 AGACATAGAGGACCACAAGCTGG No data
1053196658_1053196666 15 Left 1053196658 9:36125122-36125144 CCAGACCCATTCCAGCGTCCTCA No data
Right 1053196666 9:36125160-36125182 AGACATAGAGGACCACAAGCTGG No data
1053196659_1053196666 10 Left 1053196659 9:36125127-36125149 CCCATTCCAGCGTCCTCACAAAG No data
Right 1053196666 9:36125160-36125182 AGACATAGAGGACCACAAGCTGG No data
1053196664_1053196666 -3 Left 1053196664 9:36125140-36125162 CCTCACAAAGGGCAGAAAAGAGA No data
Right 1053196666 9:36125160-36125182 AGACATAGAGGACCACAAGCTGG No data
1053196663_1053196666 4 Left 1053196663 9:36125133-36125155 CCAGCGTCCTCACAAAGGGCAGA No data
Right 1053196666 9:36125160-36125182 AGACATAGAGGACCACAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053196666 Original CRISPR AGACATAGAGGACCACAAGC TGG Intergenic
No off target data available for this crispr