ID: 1053199404

View in Genome Browser
Species Human (GRCh38)
Location 9:36142510-36142532
Sequence AGGAGAAAGCAGGCCCGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053199399_1053199404 -5 Left 1053199399 9:36142492-36142514 CCAGCACATGGCCAGAGCAGGAG 0: 1
1: 6
2: 14
3: 52
4: 308
Right 1053199404 9:36142510-36142532 AGGAGAAAGCAGGCCCGGGATGG No data
1053199398_1053199404 -4 Left 1053199398 9:36142491-36142513 CCCAGCACATGGCCAGAGCAGGA 0: 1
1: 3
2: 9
3: 38
4: 325
Right 1053199404 9:36142510-36142532 AGGAGAAAGCAGGCCCGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053199404 Original CRISPR AGGAGAAAGCAGGCCCGGGA TGG Intronic
No off target data available for this crispr